Labshake search
Citations for Lonza :
1 - 50 of 2482 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (Lonza) and macrophage media (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... Nucleofected striatal neurons were transfected using manufacturer’s instructions (Rat Neuron Nucleofector Kit, Lonza) for rat hippocampal neurons before plating ...
-
bioRxiv - Neuroscience 2022Quote: ... cell pellet was resuspended in 100 ml Nucleofector™ (Rat Neuron Nucleofector kit, Lonza) transfection reagent and electroporated with 2 μg of cDNA mix according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Neurons were transfected before plating by using Amaxa Rat Neuron Nucleofection Kit (Lonza VPG-1003) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... Fresh substrate containing 1% agarose (SeaKem LE Agarose, Lonza), 0.8% acetic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... TG trigeminal ganglion neurons were transfected with 3 µg of NaV1.7-PEPCy3 plasmid and 0.75 µg green fluorescent protein (GFP) using the rat neuron 4D-Nucleofector solution (P3 Primary Cell Solution, program DR 114; Lonza Biosciences). Neurons were plated on round bottom glass dishes (cat ...
-
bioRxiv - Microbiology 2022Quote: ... a fresh medium containing 1% SeaPlaque Agarose (Lonza, Cat# 50100) was layered and incubated at 32 or 37°C until plaque formation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: Rat Primary hepatocytes (Wister, Lonza, RICP01) were cultured as instructed ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Cell Biology 2021Quote: ... MEFs were immortalized with pBabe-SV40Tag by electroporation using the Amaxa Mouse/Rat Hepatocyte Nucleofector Kit (Lonza, VPL-1004). Immortalized MEF lines were genotyped ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SH-SY5Y dopaminergic neuroblastoma cells were cultured in Dulbecco’s modified Eagle’s medium:F-12 (DMEM:F-12; 1:1) containing high glucose (3.151 g/L) (Lonza), supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... Rat vascular SMCs (Lonza, R-ASM-580) were grown in DMEM with 20% FBS and 1x Antibiotic-Antimyotic (Thermo Fisher Scientific).
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were nucleofected with identified plasmids prior to plating at 0 DIV using Amaxa Rat Neuron Nucleofector kit (DGP-1003; Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Hepatocytes (7×105 cells) were transfected with various plasmids (at 6 μM or indicated concentrations) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat cardiomyocyte Nucleofector Kit (Lonza, VAPE-1002) according to the manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat Neuron Nucleofector Kit (Lonza, VPG-1003) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (EGM2 media without supplementation with EGF, FGF2 and VEGF-A; Lonza) and macrophage media (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Cell Biology 2019Quote: ... and MF 1 Nucleofector kit (Lonza) according to the manufactures protocols ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... human and rat stellate cells were purchased from Lonza, and each were cultured according to their respective vendor protocols ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Rat Aortic Smooth Muscle cells (RASMC) (Lonza, Walkersville, MD) and meticulously maintained in DMEM (Gibco from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were resuspended in P3 Primary Cell Nucleofector™ Solution containing Supplement 1 (Lonza, Switzerland) and 1 µg of chemically modified sgRNA (Synthego ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified coding gene fragments of heavy-chain variable domains were separated on a 1.5% low-temperature melting agarose gel (Lonza Group AG, Basel, Switzerland). Approximately 700 base pair bands corresponding to the heavy-chain only immunoglobulin were extracted (QIAquick Gel Extraction Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.6 Supplement 1 (Lonza kit, #V4XP-3032), and 1ug of plasmid DNA or 200pmol of chemically stabilized synthetic RNA (Synthego Corp.) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing bone marrow mononuclear cells was washed in 5 ml basal medium (α – MEM containing 10% FBS and 100 U mL−1 penicillin and 100 μg mL−1 streptomycin; Lonza). All washing stages were at 400 x g for 5 minutes.
-
bioRxiv - Cell Biology 2020Quote: ... containing bone marrow mononuclear cells was washed in basal medium (α-MEM containing 10% FBS and 100 U mL-1 penicillin and 100 µg mL-1 streptomycin; Lonza). Cells were subsequently either sorted using MACS or incubated with SNAs.
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
Starvation resistant cavefish reveal conserved mechanisms of starvation-induced hepatic lipotoxicitybioRxiv - Cell Biology 2024Quote: ... and mounted in 1% Low-Melt Agarose containing 0.02% Tricaine MS-222 (50080; Lonza, Basel, Switzerland) and imaged on a glass-bottomed FluoroDish (FD3510-100 ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were re-suspended in a rat neuron transfection buffer (Lonza) and mixed with 10 μg of cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... 4ml of overlay containing a 1:1 ratio of 2x Eagle’s Minimal Essential Medium (EMEM) with 1x Pen/Strep/Glutamine (Lonza, Mount Waverley, VIC, Australia) and 1.5% agarose (Promega ...
-
bioRxiv - Genomics 2020Quote: ... containing 4uL 1X PBS (Lonza). The plates were centrifuged and immediately placed on dry ice ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 10% FBS (Lonza, Switzerland) and 1X PenStrep (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... containing Neural Survival Factor (Lonza), N2 supplement (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... containing 5uL of 1XPBS (Lonza) per well using stringent precautions against contamination [22] ...
-
bioRxiv - Biochemistry 2023Quote: ... Medium containing 5% FCS (Lonza) was used to expand and grow cells in a Cell Factory (6320 cm2 ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2 mM Ultraglutamine (Lonza), 1% Nonessential aminoacids (NEAA) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing EGM SingleQuots supplements (Lonza) (without ascorbic acid ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 5μg of selected plasmid (control, empty vector (EV) or containing guide RNAs using Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 2×105 UE control hPSCs were transfected with a pair of pSpCas9(BB)-2A-GFP constructs containing the specific sgRNAs (350 ng per construct) using P3 Primary Cell 4D-Nuclecfector X Kit (Lonza). The transfected cells were plated in Matrigel-coated dish and cultured for 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...