Labshake search
Citations for Lonza :
1 - 50 of 1783 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... All cells were authenticated by short tandem repeat analysis and confirmed negative for Mycoplasma infection with the MycoAlert Mycoplasma Detection Kit (Lonza). HCT-116 and A549 cells were cultured in DMEM ...
-
bioRxiv - Systems Biology 2021Quote: ... All of the cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). A375 ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines have been periodically subjected to re-confirmation by Short Tandem Repeat (STR) profiling by ATCC and mycoplasma testing by MycoAlertTM PLUS mycoplasma detection Kit (Lonza). YUHEF ...
-
bioRxiv - Genomics 2023Quote: ... All cell lines were authenticated by short tandem repeat (STR) profiling and verified mycoplasma free using the MycoAlert PLUS Mycoplasma Detection kit (Lonza) prior to conducting experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were authenticated by Short Tandem Repeat analysis and tested for Mycoplasma contamination with a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2022Quote: ... The reconstituted stromal-rich pancreatic tumoroid were cultured with 50% Endothelial Cell Growth Media (Lonza) and 50% DMEM/F12 medium ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely authenticated using short tandem repeat profiling and verified to be free of mycoplasma using the MycoAlert mycoplasma detection kit (Lonza Cat# LT07-418), by the QIMR Berghofer Medical Research Institute analytical facility (Brisbane ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cell line identities were confirmed by short tandem repeat profiling.77 Cell cultures were routinely tested for Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza Bioscience, cat # LT07) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell line was authenticated through short tandem repeat analysis and tested for mycoplasma contamination every 10 passages using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). PDGFR-BiFC and myr-Venus stable cells were cultured in RPMI growth medium [RPMI 1640 (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Neuroscience 2022Quote: ... Nucleofected striatal neurons were transfected using manufacturer’s instructions (Rat Neuron Nucleofector Kit, Lonza) for rat hippocampal neurons before plating ...
-
bioRxiv - Neuroscience 2022Quote: ... cell pellet was resuspended in 100 ml Nucleofector™ (Rat Neuron Nucleofector kit, Lonza) transfection reagent and electroporated with 2 μg of cDNA mix according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Neurons were transfected before plating by using Amaxa Rat Neuron Nucleofection Kit (Lonza VPG-1003) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines used in this study were authenticated using short tandem repeat genotyping (Labcorp) and confirmed to be negative for mycoplasma contamination using MycoAlertTM PLUS Assay (Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... All of the cell lines were confirmed by single-nucleotide-polymorphism array and short-tandem-repeat authentication (Genetica DNA Laboratories) and routinely tested negative for mycoplasma (MycoAlert, Lonza)
-
bioRxiv - Cell Biology 2022Quote: Rat Primary hepatocytes (Wister, Lonza, RICP01) were cultured as instructed ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Cell Biology 2021Quote: ... MEFs were immortalized with pBabe-SV40Tag by electroporation using the Amaxa Mouse/Rat Hepatocyte Nucleofector Kit (Lonza, VPL-1004). Immortalized MEF lines were genotyped ...
-
bioRxiv - Biochemistry 2020Quote: ... Rat vascular SMCs (Lonza, R-ASM-580) were grown in DMEM with 20% FBS and 1x Antibiotic-Antimyotic (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were nucleofected with identified plasmids prior to plating at 0 DIV using Amaxa Rat Neuron Nucleofector kit (DGP-1003; Lonza) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Hepatocytes (7×105 cells) were transfected with various plasmids (at 6 μM or indicated concentrations) using the Mouse/ Rat hepatocyte Nucleofector kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat cardiomyocyte Nucleofector Kit (Lonza, VAPE-1002) according to the manufacturer’s instruction.
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were nucleofected with plasmids of interest using the Lonza 2b Nucleofector and Rat Neuron Nucleofector Kit (Lonza, VPG-1003) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... human and rat stellate cells were purchased from Lonza, and each were cultured according to their respective vendor protocols ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Rat Aortic Smooth Muscle cells (RASMC) (Lonza, Walkersville, MD) and meticulously maintained in DMEM (Gibco from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were re-suspended in a rat neuron transfection buffer (Lonza) and mixed with 10 μg of cDNA ...
-
bioRxiv - Genomics 2020Quote: ... containing 4uL 1X PBS (Lonza). The plates were centrifuged and immediately placed on dry ice ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 10% FBS (Lonza, Switzerland) and 1X PenStrep (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... containing Neural Survival Factor (Lonza), N2 supplement (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... containing 5uL of 1XPBS (Lonza) per well using stringent precautions against contamination [22] ...
-
bioRxiv - Biochemistry 2023Quote: ... Medium containing 5% FCS (Lonza) was used to expand and grow cells in a Cell Factory (6320 cm2 ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2 mM Ultraglutamine (Lonza), 1% Nonessential aminoacids (NEAA) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing EGM SingleQuots supplements (Lonza) (without ascorbic acid ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 5μg of selected plasmid (control, empty vector (EV) or containing guide RNAs using Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Genetics 2020Quote: ... 2×105 UE control hPSCs were transfected with a pair of pSpCas9(BB)-2A-GFP constructs containing the specific sgRNAs (350 ng per construct) using P3 Primary Cell 4D-Nuclecfector X Kit (Lonza). The transfected cells were plated in Matrigel-coated dish and cultured for 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... were purchased from ATCC and cultured in endothelial cell growth basal medium-2 containing bullet kit growth factor supplements (EBM-2 [endothelial cell growth basal medium-2]; Lonza), 5% fetal bovine serum ...
-
bioRxiv - Bioengineering 2023Quote: ... hepatocytes were electroporated using 100 µL Mouse/Rat Hepatocyte Nucleofector solution (Lonza) and conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... Media was then changed to EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were purchased from ATCC and cultured in EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 5% fetal bovine serum ...