Labshake search
Citations for Lonza :
1 - 50 of 1648 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were checked regularly for mycoplasma contamination by PCR (MycoAlert™ Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were regularly tested for mycoplasma contamination by PCR and MycoAlert Mycoplasma Detection Kit (Lonza). Avapritinib and MK-1775 were obtained from Selleckchem (Houston ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... Cells were then washed with CyFACS buffer and incubated for 5min at RT in 1xPBS (Lonza) with 1/1000 diluted cisplatin (Fluidigm) ...
-
bioRxiv - Microbiology 2021Quote: ... electroporated with 10 μg of linearised plasmid DNA or PCR product using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (Lonza, Switzerland, program X-001).
-
bioRxiv - Cell Biology 2019Quote: ... Flies were then dissected at room temperature (RT) in Grace’s Insect Medium (modified) (BioWhittaker, Lonza, Cologne, Germany). Ovaries were homogenized in 150 uL of sample buffer and proteins were separated on 4-20% polyacrylamide gels using a standard SDS-PAGE protocol for Western blotting ...
-
bioRxiv - Cell Biology 2019Quote: ... 3x 10 flies were then dissected at room temperature (RT) in Grace’s Insect Medium (modified) (BioWhittaker, Lonza, Cologne, Germany). Ovaries were fixed for 20 minutes in 4% paraformaldehyde and 20mM formic acid solution (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 10×106 CD8+ T cells were resuspended in 250 µL of RT red phenol-free serum-free TheraPEAKTM X-VIVOTM-15 (BEBP02-061Q, Lonza). 10 µg of RNA coding for the α and β chains of the TCR recognizing the S7C epitope of NY-ESO-1 presented on HLA-A*02:01 (NY-ESO (157-165) ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were separated on 3.5% MetaPhor Agarose gel (Lonza). When both genotyping and phenotypic analyses of single zebrafish embryos from heterozygous bach2a intercross was needed ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were separated on a 2% MetaPhor agarose (Lonza) gel with SYBRSafe (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was analyzed in 1.5% agarose (Lonza 50002) gel stained by SYBR Safe (Invitrogen S33102 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Genetics 2019Quote: ... All PCR products were monitored with FlashGels (Lonza, Basel, Switzerland) to confirm the anticipated length depending on locus ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were run on 2.2% agarose gels (Lonza 57031) and imaged using Philips VLounge software ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed 1x in RT PBS and transfected with ∼15μg of DNA plasmid using Amaxa nucleofector 2b (Lonza, program O-005). After transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR products were separated on homemade MetaPhor agarose gel (Lonza) and stained with GelRed ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR samples were analyzed on 2% agarose gels (Lonza Rockland, ME), 1X TAE ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... and tested for mycoplasma using PCR and biochemical test (MycoAlert, Lonza).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were separated on a 2% MetaPhorTM agarose gel (Lonza) and smeared amplicons were gel-excised using the MinElute gel extraction Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were resolved on a MetaPhor gel (Lonza, Basel, Switzerland) and sequenced ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were run on 4% Nusieve agarose gel (Cat #50090, LONZA) for higher resolution of bands separation results (Witt ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR cycle number was evaluated using a FlashGelTM System (Lonza, 57063). The volume of the PCR product was adjusted to 100 μL by adding 50 µl TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were loaded on 1.5% agarose gel (Lonza SeaKem LE Agarose) at constant voltage of 70V for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR samples were visualized on 1.5% SeaKem LE agarose (Lonza; Rockland, ME) gels containing 0.5x GelRed (Biotium ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were visualized on a FlashGel™ system (Lonza, Basel, Switzerland), cleaned up using ExoSAP-IT Express (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR tubes were placed above a gel-viewing blue LED powered light box (Lonza Flashgel Dock or IO Rodeo Midi Blue LED Transilluminator ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products and double-stranded DNAs were purified with agarose gels (Lonza, 50004) and the GeneJet Gel Extraction Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Cancer Biology 2021Quote: Mycoplasma Detection Kits (Lonza) and MycoSensor qPCR Assay Kits (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Immunology 2019Quote: The Nucleofector transfection kit (Lonza) was used to transfect siRNA into cells ...
-
bioRxiv - Microbiology 2023Quote: A ToxiLight BioAssay Kit (Lonza) was used to determine cell death ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ToxiLight bioassay kit (Lonza) according to the manufacture’s recommendations.
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.