Labshake search
Citations for Lonza :
1 - 50 of 1639 citations for RNA Amplification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Amplification products were visualized by SYBR® Green (Lonza Group AG). The following conditions were generally applied ...
-
bioRxiv - Plant Biology 2020Quote: ... Amplification products were visualized by SYBR® Green (Lonza Group AG). Following conditions were generally applied ...
-
bioRxiv - Genomics 2021Quote: ... or no RNA (mock) using Amaxa cell line Nucleofector kit V (Lonza) and electroporated using G-30 program ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Bioengineering 2021Quote: ... 200,000 cells were electroporated with 1000 ng adRNA plasmid or 48 pmol of IVT RNA using the Amaxa SF cell Line 4D-Nucleofector X kit (Lonza) as per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 5μg of selected plasmid (control, empty vector (EV) or containing guide RNAs using Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA vectors were nucleofected into the LaminB CRISPRi iPSC line using a P3 Primary Cell 96-well NucleofectorTM Kit (Lonza) and the 4D Nucleofector X Unit (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was separated on formaldehyde agarose gels (Lonza) and stained with SYBR Gold Nucleic Acid Gel Stain (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Cancer Biology 2021Quote: Mycoplasma Detection Kits (Lonza) and MycoSensor qPCR Assay Kits (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA in the gel was stained with GelStar™ (Lonza) and imaged with an Azure 6000 Imaging System (Azure Biosystems) ...
-
bioRxiv - Immunology 2019Quote: The Nucleofector transfection kit (Lonza) was used to transfect siRNA into cells ...
-
bioRxiv - Microbiology 2023Quote: A ToxiLight BioAssay Kit (Lonza) was used to determine cell death ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ToxiLight bioassay kit (Lonza) according to the manufacture’s recommendations.
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing (MycoAlert Detection Kit, Lonza) was performed monthly.
-
bioRxiv - Cell Biology 2022Quote: ... using MycoAlert detection kit (Lonza, LT07). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...
-
bioRxiv - Cancer Biology 2020Quote: ... using MycoAlert™ kit (Lonza, Germany) and genetically authenticated using a STR-PCR fragments kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... Kit T solution (Lonza, Basel, Switzerland), and programs G-016 ...
-
bioRxiv - Cell Biology 2019Quote: ... and MF 1 Nucleofector kit (Lonza) according to the manufactures protocols ...
-
bioRxiv - Immunology 2021Quote: ... Nucleofector Kit V was from Lonza. The original vector pCasper-GR (#FP971 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with the SingleQuots kit (Lonza), 5 μg/ml transferrin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Nucleofector Kit V (Lonza, VCA-1003); paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2023Quote: ... with the full growth kit (Lonza) and passaged using TrypLE Express.
-
bioRxiv - Molecular Biology 2023Quote: ... Mycoplasma detection kit (Lonza #LT07-318) was used as per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: Cell□line□specific Nucleofector Kits (Lonza) were used for transfections which were performed according to manufacturer’s protocol on a Nucleofector® 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... using MycoAlert detection kit (Lonza, LT07). For co-immunoprecipitation experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... and verified mycoplasma free by Lonza MycoAlert mycoplasma detection kit (LT07, Lonza). Fibroblasts were synchronized by temperature cycles of 12 h 32°C followed by 12 h 37°C for 5 days ...
-
bioRxiv - Microbiology 2024Quote: Toxilight Bioassay Kit (Lonza, LT17-127) or LDH-Glo Cytotoxicity Assay (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were regularly checked for mycoplasma contamination using a luminescence-based kit (Lonza, MycoAlertTM Mycoplasma Detection Kit).
-
bioRxiv - Bioengineering 2024Quote: ... Electroporation kit V and Electroporation kits for Primary T-Cell/HSPC were purchased from Lonza (Basel, Switzerland) and used on the Lonza Nucleofector 2b system ...
-
bioRxiv - Synthetic Biology 2019Quote: ... using the SF Cell Line 4D-Nucleofector® × Kit L or × Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using SF Cell line 4D-Nucleofector X Kit L or X Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Kit S (both from Lonza, Basel, Switzerland). HDR was stimulated by HDR enhancer (IDT ...
-
bioRxiv - Bioengineering 2021Quote: ... and EGM-2 SingleQuot bullet kit (Lonza). For imaging experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and the Human Monocyte Nucleofector Kit (Lonza) as previously described (Schnoor et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with EGM-2 SingleQuot Kit (Lonza). HPAEC were cultured in multi-well cell culture plates and flasks coated with 0.1 % gelatin ...
-
bioRxiv - Immunology 2022Quote: ... Vienna) were electroporated (Nucleofector Kit; Lonza, Switzerland) with two Cas9/sgRNA vectors encoding GFP as a marker and the targeting DNA template containing the miRNA cluster flanked by loxP sites ...