Labshake search
Citations for Lonza :
1 - 50 of 2076 citations for PEGSSDA 2 x 0.5 mL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Exponentially growing Sf9 cells (2 x 106 cells/mL in Lonza Insect-XPRESS medium supplemented with 0.1 mM biotin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...
-
bioRxiv - Immunology 2021Quote: ... and soluble anti-CD28 (500 ng/mL) at a density of 2 × 106 cells/mL of X-vivo 15 serum-free medium (Lonza). For iTreg differentiation ...
-
bioRxiv - Bioengineering 2019Quote: ... or γδ-T cells were activated and cultured for 2 days at 0.5 to 1.0 million cells/mL in XVivo15 medium (Lonza) with 5% Fetal Bovine Serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... and hEGF [0.5 mL] aliquots) (Lonza, CC-4124), Heat Inactivated Fetal Bovine Serum (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... 4 x 104 in 0.4 mL MEM (Lonza), 10% FBS (Corning) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 x 106 primary urine cells were reprogrammed using the Amaxa Basic Nucleofector Kit (Lonza) according to the protocol of the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... incubated with 5 ml of 0.5 mM EDTA (Lonza) at 37° C for 2 minutes to detach the cells ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and γδ T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 medium (Lonza) (5% fetal bovine serum ...
-
bioRxiv - Bioengineering 2020Quote: 2 million UCB-MNC/mL were cultured in X-VIVO 15 serum-free cell-culture medium (Lonza Group Ltd, Basel, Switzerland), supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in 10 ml X-VIVO 15 medium (Lonza) and incubated at 37°C for 24h remove the Galectin-3 produced by OP9 stromal cells ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml of 2% SeaPlaque™ Agarose (Lonza) in DMEM containing 2% FBS and 1% penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in DMEM containing 2% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... UCB-MNC were thawed and cultured at 2 million cells/mL in X-VIVO 15 serum-free cell-culture medium (Lonza, Basel, Switzerland) supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Genomics 2020Quote: ... 100 μg/mL streptomycin in X-VIVO 15 (Lonza, BW04418Q). From this point on ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1-μg/mL αCD28) in X-VIVO 15 (Lonza). T cells (2.5 × 105 ...
-
bioRxiv - Microbiology 2022Quote: ... a 3 ml of DMEM containing 0.5% SeaKem ME agarose (Lonza), 5% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... in 20 ml ice-cold X-Vivo media (Lonza, Basel, Switzerland). FBM mononuclear cells were isolated by centrifugation for 30 minutes at room temperature on a Ficoll gradient (StemCell Technologies ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 x 105 cells were resuspended in 100uL of P2 medium (Lonza) containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µM electroporation enhancer (IDT)) into 2 x 105 KPC cells on a Nucleofector 4D (Lonza Biosciences, Walkersville, MD) with an SF kit (Catalog ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Bioengineering 2024Quote: ... Beads were mixed at a 1:1 ratio with cells and cells were cultured at a density of 1 x 106 cells/mL in complete X-Vivo 15 culture media (Lonza, 5% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100 ng/mL and 0.5 µg/mL or 1 µg/mL were used in Mammary Epithelial Growth Medium (Lonza, CC-3150), respectively ...
-
bioRxiv - Immunology 2022Quote: ... and resuspended in 5 mL of X-VIVOTM 15 (Lonza, BE02-060F) + 10% FBS (PEAK Serum ...
-
bioRxiv - Immunology 2020Quote: ... and transduced with lentivirus to express CAR (MOI=2) in X-VIVO 15 (Lonza) containing 10% FCS with 5 μg/mL protamine sulfate (APP Pharmaceuticals) ...
-
bioRxiv - Biochemistry 2020Quote: ... Large-scale suspension cultures (300 mL) of High Five insect cells at 0.5 × 106 cells/ml were grown in Insect-Xpress media (Lonza) and inoculated with P2 baculovirus solution containing the Rpc5 constructs ...
-
bioRxiv - Immunology 2023Quote: ... 1×106 cells/mL were cultured in X-vivo 15 (Lonza, Basel, Switzerland) serum-free media supplemented with human transforming growth factor beta 1 (TGF-β1) ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 μg/ml fibroblast growth factor 2 (FGF-2) (Lonza, Basel-Stadt, Switzerland) and 1% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... Purified B cells were then cultured at 0.5 ×106 cells/mL in RPMI 1640 (Lonza) containing penicillin (100 IU/ml) ...
-
bioRxiv - Immunology 2021Quote: CD4+ T cells were activated with plate-bound α-CD3 (3.75 µg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Immunology 2021Quote: ... CD4+ T-cells were stimulated with plate-bound α-CD3 (3.75 μg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Microbiology 2023Quote: ... 0.4 µg/ml hydrocortisone (Upjohn 100mg SERB), 0.5 µg/ml insulin (Novo Nordisk, Novorapid Flexpen) and 1× penicillin/streptomycin (LONZA, Verviers, Belgium). The flasks were incubated at 37°C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... X-Vivo 15 medium: X-Vivo 15 (Lonza) supplemented with 1% Glutamax ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were grown in 15 mL EBM-2 (Lonza) supplemented with EGM-2 MV SingleQuot Kit (Lonza ...
-
bioRxiv - Biophysics 2023Quote: ... and in 5 mL culture medium (SmGM-2, Lonza) at last ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended at 1×106 cells/ml in XH media (X-Vivo 15 (Lonza) with 5% human serum ...
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Immunology 2020Quote: ... RBCs were lysed with 2 mL ACK lysis buffer (Lonza). Prior to surface staining ...
-
bioRxiv - Microbiology 2021Quote: ... 0.05mg/ml gentamicin and 2% low melting point agarose (Lonza) and incubated at 37°C/5% CO2 for 72 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... 100M PBMCs were thawed in 100 mL X-VIVO™ 10 media from Lonza (#04-380Q) with recombinant human IL-2 protein from R&D Systems (#202-IL) ...
-
bioRxiv - Genomics 2021Quote: ... and 0.5% UltraGlutamin (Lonza). Hap1 SA1 and SA2 knock-out cells were generated using gRNA’s targeting SA1 exon 2 (ACTACTGCCCATTCCGATGC ...
-
bioRxiv - Bioengineering 2024Quote: ... with L-ascorbic acid-2-phosphate (AA2P) (5mg/ml stock, 10 µl/ml), and β-glycerolphosphate (BGP) (20 mM stock, 20 µl/ml) (Lonza). The cell culture medium was changed every 3 days ...
-
bioRxiv - Immunology 2021Quote: ... 2×106 cells were nucleofected with 2μg of pcDNA3.1+ plasmid per reaction (Lonza-AMAXA program X-001, Nucleofector 2b). 24 hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... the PBS was removed and 3 mL of SkBM-2 (Lonza) media was added to each chamber ...
-
bioRxiv - Pathology 2023Quote: ... and the cell pellet was resuspended in 10 mL of Endothelial Cell Growth Medium-2 (EGM-2, Lonza). The cell suspension was plated into a 75 cm2 tissue culture treated flask and cultured in a 5% CO2 incubator at 37°C ...