Labshake search
Citations for Lonza :
1 - 50 of 62 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 2x Phusion® High-Fidelity PCR Master Mix with HF buffer and 8.6 μl AccuGene molecular biology water (Lonza, Basel, CH). PCR cycling conditions were ...
-
bioRxiv - Immunology 2022Quote: ... 1 million NK cells were resuspended in 20 ul 4D nucleofector master mix (82% P3 + 18% supplement 1; Lonza, V4XP-3032) and then mixed with Cas12a RNPs for electroporation using program CM137 (87) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 million NK cells were resuspended in 20 μl Amaxa 4D nucleofector master mix (82% P3 + 18% supplement 1) (Lonza, V4XP-3032), then mixed with Cas12a RNPs for electroporation using program CM137 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% penicillin-streptomycin mix (Lonza, DE17-602E). HCT116 and U2OS cells were grown in McCoy’s medium (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (Lonza) and macrophage media (v/v ...
-
bioRxiv - Immunology 2019Quote: ... 5mM EDTA and 1% antibiotic mix (pen-strep-AmphoB; Fisher-Lonza). After incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... a plasmid mix was prepared consisting of 1uL of Electroporation Enhancer (100uM, Lonza), 1.5 uL of 2ug/uL ABE8e-NRCH ribonucleoprotein editor,83 1uL of base editor primer (50uM stock ...
-
bioRxiv - Bioengineering 2022Quote: ... 7.1 μL of the reaction mix were placed on a Gel Slick™ (Lonza)-coated glass slide ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples on day 6 were dissociated with enzyme mix composed of 0.5×Versene (Lonza, 17711E), 0.5×Accumax (STEMCELL Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... The AAV mix was added diluted in hepatocyte basal media (HBM, Lonza, Cat# CC-3199). Media was changed daily for three days ...
-
bioRxiv - Cancer Biology 2022Quote: ... nucleofection mix was prepared as follows: 16.4 uL Primary P3 Buffer (Lonza kit, #V4XP-3032), 3.6 Supplement 1 (Lonza kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation mix was prepared resuspending RPE1 cells in P3 Primary Cell Full Electroporation Buffer (Lonza), and adding previously prepared RNPs ...
-
bioRxiv - Neuroscience 2020Quote: ... Each mix was transferred to a Nucleocuvette and electroporated using the 4D-nucleofector Core Unit (LONZA) using the program CA-137 ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were separated on 3.5% MetaPhor Agarose gel (Lonza). When both genotyping and phenotypic analyses of single zebrafish embryos from heterozygous bach2a intercross was needed ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were separated on a 2% MetaPhor agarose (Lonza) gel with SYBRSafe (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was analyzed in 1.5% agarose (Lonza 50002) gel stained by SYBR Safe (Invitrogen S33102 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Genetics 2019Quote: ... All PCR products were monitored with FlashGels (Lonza, Basel, Switzerland) to confirm the anticipated length depending on locus ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were run on 2.2% agarose gels (Lonza 57031) and imaged using Philips VLounge software ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR products were separated on homemade MetaPhor agarose gel (Lonza) and stained with GelRed ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR samples were analyzed on 2% agarose gels (Lonza Rockland, ME), 1X TAE ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... and tested for mycoplasma using PCR and biochemical test (MycoAlert, Lonza).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were separated on a 2% MetaPhorTM agarose gel (Lonza) and smeared amplicons were gel-excised using the MinElute gel extraction Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (EGM2 media without supplementation with EGF, FGF2 and VEGF-A; Lonza) and macrophage media (v/v ...
-
bioRxiv - Genomics 2020Quote: ... Exactly 100μl of the transfection mix in Amaxa cuvette was electroporated in a Nucleofector 2B Device (Lonza™) using the program U33 ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were resolved on a MetaPhor gel (Lonza, Basel, Switzerland) and sequenced ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were run on 4% Nusieve agarose gel (Cat #50090, LONZA) for higher resolution of bands separation results (Witt ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR cycle number was evaluated using a FlashGelTM System (Lonza, 57063). The volume of the PCR product was adjusted to 100 μL by adding 50 µl TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were loaded on 1.5% agarose gel (Lonza SeaKem LE Agarose) at constant voltage of 70V for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR samples were visualized on 1.5% SeaKem LE agarose (Lonza; Rockland, ME) gels containing 0.5x GelRed (Biotium ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were visualized on a FlashGel™ system (Lonza, Basel, Switzerland), cleaned up using ExoSAP-IT Express (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... A total of 5 × 105 cells were suspended in 100 μL of Nucleofector V solution mix (Lonza, VCA-1003) with 2 μg of GZMA and RASGRP1 CRISPR/Cas9 plasmids and subjected to nucleofection using the cell line-specific program T-O17 ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell / Amaxa solution mixture was added to the RNP mix and then pipetted into the bottom of a 96-well nucleofection plate (Lonza). This sample was then nucleofected using the 4D-Nucleofector Core unit and 96-well shuttle device (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of the 4sgRNA plasmid or 10 µM synthetic guide RNAs were mixed and the cell/reagent/nucleofection mix was transferred to Nucleofection cuvette strips (Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mixed by pipetting with the full gRNA-Cas9 complex mix previously assembled then added in the electroporation chamber well (Lonza, V4XP3032). Cells were electroporated with the program EO-100 using the Lonza Nucleofector ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pelleted organoids were resuspended in 20uL of nucleofection mix and transferred to electroporation chamber (Lonza kit, #V4XP-3032, 96-well format) for electroporation using Lonza X Unit Nucleofector under the [ES ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR tubes were placed above a gel-viewing blue LED powered light box (Lonza Flashgel Dock or IO Rodeo Midi Blue LED Transilluminator ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products and double-stranded DNAs were purified with agarose gels (Lonza, 50004) and the GeneJet Gel Extraction Kit (Thermo Fisher ...
-
bioRxiv - Physiology 2020Quote: Growth media used for the expansion of human muscle-derived cell populations consisted of Hams F-10 nutrient mix (Lonza, Basel, Switzerland) with added L-glutamine (2.5 mM) ...
-
bioRxiv - Bioengineering 2023Quote: ... MCF-10A cells were cultured using an MEGM™ Mammary Epithelial Cell Growth Medium BulletKit™ without gentamycin-amphotericin B mix (Lonza) following ATCC’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were checked regularly for mycoplasma contamination by PCR (MycoAlert™ Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...