Labshake search
Citations for Lonza :
1 - 50 of 1645 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were authenticated by Brca1/2-specific PCR-based genotyping (mouse)7,8 and they were regularly tested for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were routinely verified via STR genotyping and tested for mycoplasma contamination using the Lonza MycoAlert assay (Lonza). Below is a list of cell line details:
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines used in this study were authenticated using short tandem repeat genotyping (Labcorp) and confirmed to be negative for mycoplasma contamination using MycoAlertTM PLUS Assay (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were checked regularly for mycoplasma contamination by PCR (MycoAlert™ Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were regularly tested for mycoplasma contamination by PCR and MycoAlert Mycoplasma Detection Kit (Lonza). Avapritinib and MK-1775 were obtained from Selleckchem (Houston ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Microbiology 2021Quote: ... electroporated with 10 μg of linearised plasmid DNA or PCR product using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (Lonza, Switzerland, program X-001).
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were separated on 3.5% MetaPhor Agarose gel (Lonza). When both genotyping and phenotypic analyses of single zebrafish embryos from heterozygous bach2a intercross was needed ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were separated on a 2% MetaPhor agarose (Lonza) gel with SYBRSafe (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was analyzed in 1.5% agarose (Lonza 50002) gel stained by SYBR Safe (Invitrogen S33102 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Genetics 2019Quote: ... All PCR products were monitored with FlashGels (Lonza, Basel, Switzerland) to confirm the anticipated length depending on locus ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were run on 2.2% agarose gels (Lonza 57031) and imaged using Philips VLounge software ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR products were separated on homemade MetaPhor agarose gel (Lonza) and stained with GelRed ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR samples were analyzed on 2% agarose gels (Lonza Rockland, ME), 1X TAE ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... and tested for mycoplasma using PCR and biochemical test (MycoAlert, Lonza).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were separated on a 2% MetaPhorTM agarose gel (Lonza) and smeared amplicons were gel-excised using the MinElute gel extraction Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were resolved on a MetaPhor gel (Lonza, Basel, Switzerland) and sequenced ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were run on 4% Nusieve agarose gel (Cat #50090, LONZA) for higher resolution of bands separation results (Witt ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR cycle number was evaluated using a FlashGelTM System (Lonza, 57063). The volume of the PCR product was adjusted to 100 μL by adding 50 µl TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were loaded on 1.5% agarose gel (Lonza SeaKem LE Agarose) at constant voltage of 70V for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR samples were visualized on 1.5% SeaKem LE agarose (Lonza; Rockland, ME) gels containing 0.5x GelRed (Biotium ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were visualized on a FlashGel™ system (Lonza, Basel, Switzerland), cleaned up using ExoSAP-IT Express (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR tubes were placed above a gel-viewing blue LED powered light box (Lonza Flashgel Dock or IO Rodeo Midi Blue LED Transilluminator ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products and double-stranded DNAs were purified with agarose gels (Lonza, 50004) and the GeneJet Gel Extraction Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Cancer Biology 2021Quote: Mycoplasma Detection Kits (Lonza) and MycoSensor qPCR Assay Kits (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Immunology 2019Quote: The Nucleofector transfection kit (Lonza) was used to transfect siRNA into cells ...
-
bioRxiv - Microbiology 2023Quote: A ToxiLight BioAssay Kit (Lonza) was used to determine cell death ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ToxiLight bioassay kit (Lonza) according to the manufacture’s recommendations.
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing (MycoAlert Detection Kit, Lonza) was performed monthly.
-
bioRxiv - Cell Biology 2022Quote: ... using MycoAlert detection kit (Lonza, LT07). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...