Labshake search
Citations for Lonza :
1 - 11 of 11 citations for Nuclease, Micrococcal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 20 pmol Cas9 nuclease (sgRNA to Cas9 nuclease ratio used as 9:1) was performed with Amaxa 2D Nucleofector (Lonza, program B016). After recovery ...
-
bioRxiv - Cancer Biology 2020Quote: ... recombinant Cas9 nuclease (IDT) and the 4D-Nucleofector (Lonza) as previously described (Wagenblast et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Cas9 Nuclease V3 (IDT) and 3.0 μg donor fragment per 100 μL of Nucleofector™ Solution V (Lonza) using the Amaxa Nucleofector II (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... complex containing Alt-R HiFi Cas9 Nuclease (IDT) and a tracrRNA:crRNA duplex (crRNA sequence: GGTCGTTGAGGACTTCCACA) using program CM150 of the Amaxa 4D Nucleofector (Lonza). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... single guide hybrids were mixed with 3uM Cas9 nuclease (Berkeley Labs) at a 1.2:1 ratio and delivered to cells by Lonza 3D (CA-137 ...
-
bioRxiv - Immunology 2022Quote: ... was prepared by mixing 250 nmol target gene sgRNA+ 50 nmol eGFP sgRNA+ 50 nmol SpCas9 2NLS Nuclease (Synthego) in 50 μL mouse B cell nucleofection buffer (Lonza) at RT for 30min ...
-
bioRxiv - Microbiology 2023Quote: ... or 1×106 CEM-M7 Cas9 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pmol) (Lonza) using a non-targeting or a GRN(5’-GCGATCCTGCTTCCAAAGATC-3’) ...
-
bioRxiv - Immunology 2023Quote: ... Mixtures of complexed sgRNA and Cas9 (0.3 nmol synthetic sgRNA + 62 µmol Cas9 nuclease) and 2-10×106 enriched murine CD8+ T cells were suspended in 25ul of P3 electroporation buffer (Lonza) and electroporated using the Lonza 4D Nucleofector (pulse code DN100) ...
-
bioRxiv - Immunology 2023Quote: ... Electroporation was performed with sgRNA/Cas9 RNP complexes using Alt-R Sp Cas9 Nuclease V3 (IDT) and using the 4D-Nucleofector with P3 Primary Cell 4D Nucleofector X Kit S (Lonza Bioscience).
-
bioRxiv - Neuroscience 2022Quote: ... together with 20 µg of HiFi Cas9 Nuclease V3 (Cat: #1081060, IDT) using Amaxa™ 4D-Nucleofector™ (Cat: #AAF-1002B, Lonza) transfection system with Primary Cell Optimization 4D-Nucleofector X Kit (Cat ...