Labshake search
Citations for Lonza :
1 - 50 of 1805 citations for Mouse VPS10 domain containing receptor SorCS1 SORCS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Silencing of the zinc receptor Gpr39 was performed by electroporation using Nucleofector electroporation kit (VPI-1001, Lonza) for exECs (Program M-003 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Neuroscience 2020Quote: ... and the Mouse Neuron Nucleofector Kit (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the mouse ES cell nucleofection kit (Lonza) using protocol “A24” ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse neuron nucleofectorTM kit (VPG-1001, Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Developmental Biology 2019Quote: ... Nucleofection was performed with the Nucleofector Kit for mouse ESC (Lonza), using 2.5 μg of DNA and the Amaxa A-013 program ...
-
bioRxiv - Immunology 2024Quote: ... using the Amaxa Mouse Dendritic Cell Nucleofector Kit (#VPA-1011, Lonza) as previously described (12 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: NPCs were collected in nucleofection solution (Amaxa Mouse NSC Nucleofector Kit, Lonza) and electroporated with 5e6 or 1e6 copies/cell of 5’ biotinylated 145bp AAV ITR ssDNA or scrambled control (ITR ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the Mouse ES cell Nucleofector kit (Lonza, Cat No. VPH-1001). 36 hours after transfection the cells were selected by 2μg/ml puromycin for 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... and the mouse neuron Nucleofector® Kit (Cat Number: VPG-1003, Lonza), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: CRISPR/Cas9 was used to knockout the coxsackie and adenovirus receptor CXADR by nucleofection (Lonza, Basel Switzerland). Well-differentiated human airway epithelia were lifted in TrypLE and electroporated with ribonucleoproteins (RNP) ...
-
bioRxiv - Microbiology 2019Quote: ... Cell pellets were resuspended in nucleofector buffer (Amaxa Mouse Macrophage Nucleofector Kit (Lonza)) and 2ug of siRNA was added to each tube (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... ESCs were electroporated using Nucleofector II (Amaxa) and mouse ESC Nucleofector kit (Lonza). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with the Amaxa Mouse Neuron Nucleofector Kit (Lonza, VPG-1001) using the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Genetics 2023Quote: ... The Amaxa Mouse Embryonic Stem Cell Nucleofector Kit was used (Lonza, VPH-1001), program A-24 ...
-
bioRxiv - Genomics 2022Quote: ... Nucleofection solutions and cuvette were from Mouse ES Cell Nucleofector kit (Lonza, VPH-1001). Nucleofector (Lonza 2b ...
-
bioRxiv - Neuroscience 2021Quote: ... An Amaxa Nucleofector 2b Device and a Mouse Embryonic Fibroblast Nucleofector Kit 1 (Lonza) were used to transfect MEFs with βCTF-3xFLAG plasmid using program N-024 of the Nucleofector (Supplementary Figure 3).
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified coding gene fragments of heavy-chain variable domains were separated on a 1.5% low-temperature melting agarose gel (Lonza Group AG, Basel, Switzerland). Approximately 700 base pair bands corresponding to the heavy-chain only immunoglobulin were extracted (QIAquick Gel Extraction Kit ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfections of primary cells were all performed with the Amaxa Mouse Neuron Nucleofector Kit (Lonza), using the O-005 nucleofection program ...
-
bioRxiv - Cell Biology 2021Quote: ... the media was changed to α-MEM containing macrophage colony-stimulating factor (M-CSF; 10 ng/ml) and and 66ng/ml receptor activator of nuclear factor kappa-B ligand (RANKL, Lonza Biosciences). OC activity was measured by releasing the europium conjugated human Type I collagen-coated on the bottom of the OsteoLyse™ Assay Kit (Lonza Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: Xist knockdown was performed following manufacturer’s instructions for the Mouse Neural Stem Cell Nucleofector Kit (Lonza). 3-5×106 NSCs were collected and resuspended in 70 μL Nucleofector solution ...
-
bioRxiv - Genetics 2021Quote: ... Transfection was carried out by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. After 2 days of transfection GFP expressing cells were FACS sorted and sparsely seeded for clonal expansion on 15cm plate ...
-
bioRxiv - Genomics 2021Quote: ... using a Nucleofector™ 2b device and the Mouse ES Cell Nucleofector Kit (Lonza, VAPH-1001) according to the manufacturer’s instructions and plated into two 10 cm dishes ...
-
bioRxiv - Genomics 2020Quote: ... containing 4uL 1X PBS (Lonza). The plates were centrifuged and immediately placed on dry ice ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 1% Pen-Strep (Lonza). Cells were thawed in medium supplemented with 10% FBS (Sigma Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 10% FBS (Lonza, Switzerland) and 1X PenStrep (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... containing Neural Survival Factor (Lonza), N2 supplement (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... containing 5uL of 1XPBS (Lonza) per well using stringent precautions against contamination [22] ...
-
bioRxiv - Biochemistry 2023Quote: ... Medium containing 5% FCS (Lonza) was used to expand and grow cells in a Cell Factory (6320 cm2 ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2 mM Ultraglutamine (Lonza), 1% Nonessential aminoacids (NEAA) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing EGM SingleQuots supplements (Lonza) (without ascorbic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... T47D cells were transiently transfected with the avian tumor virus receptor A (TVA) by using electroporation (preset “FF150” program, 4D-Nucleofector transfection system; Lonza, Cologne, Germany). The cell suspension was cultured with full medium at 37 °C and 5% CO2 for 24 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 5μg of selected plasmid (control, empty vector (EV) or containing guide RNAs using Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...