Labshake search
Citations for Lonza :
1 - 50 of 685 citations for Modified Jis Pcb Alt B Calibration Solution Cs0.4H Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).
-
bioRxiv - Biochemistry 2024Quote: 1 µL of 63 µM Alt-R™ S.p.Cas9 V3 (IDT: 10007807) was diluted with 18 µL of SE Cell Line Nucleofector® Solution (Lonza V4XC-1032), followed by the addition of 1.8 µL of 100 µM sgRNA (3:1 sgRNA:Cas9) ...
-
bioRxiv - Systems Biology 2019Quote: ... and 1% penicillin-streptomycin-amphotericin B solution (Lonza, Walkersville, MD, USA). Cells were grown on Matrigel (BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer’s instructions (Lonza) at a concentration of 4 - 5 × 106 cells / 86 μL ...
-
bioRxiv - Physiology 2022Quote: ... and 2.5 μg/mL amphotericin B in Hank’s balanced salt solution (HBSS) (Lonza, UK). It was then finely minced and digested overnight on a rocker at 4 °C in 1 mg/mL protease XIV (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... and 25 ng/ml of amphotericin B. HEK293 cells (obtained from M. Marketon’s laboratory) were maintained in Dulbecco’s modified essential medium (DMEM) (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Annealed tracrRNA/gRNA was complexed with Cas9 (Alt-R; IDT) and RNPs were electroporated (Lonza) into cells following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA complex and Alt-R HDR Donor Oligos were transfected into HCT116 cells by electroporation (Lonza Nucleofector 96-well Shuttle System ...
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 μM Alt-R Cas9 Electroporation enhancer (IDT) and 4 μM single-strand DNA homology template (Ultramer DNA Oligonucleotide, Lonza). After electroporation ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA complex and Alt-R HDR Donor Oligos were transfected into HCT116 cells by electroporation (Lonza Nucleofector 96-well Shuttle System; Lonza, Bend, OR) using parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Systems Biology 2020Quote: ... amphotericin B (Lonza 17-836E), and gentamicin (Lonza 17-518 ...
-
bioRxiv - Physiology 2022Quote: ... Amphotericin-B (CC-4081C, Lonza), ascorbic acid (CC-4116C ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Amphotericin B (17-936E, Lonza). YUMM1.7 cells were cultured in DMEM/F-12 medium with L-Glutamine and 15mM HEPES (11330 ...
-
bioRxiv - Cell Biology 2019Quote: ... in Dulbecco’s Modified Eagle’s Medium (Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... cultured in modified EBM-2 (Lonza) - containing 0.025% VEGF ...
-
bioRxiv - Cancer Biology 2019Quote: ... and with Pen/Strep Amphotericin B (Lonza) in an atmosphere of 95% air and 5% CO2 at 37°C.
-
bioRxiv - Bioengineering 2020Quote: ... and gentamicin/amphotericin-B (Lonza, Walkersville, MD). MSCs were cultured in low glucose DMEM and L-glut media ...
-
bioRxiv - Molecular Biology 2023Quote: ... A nucleofector II-b device (Amaxa, Lonza), program A-30 with 10 µg of plasmid DNA and 1 µg of eGFP control plasmid (Amaxa ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Immunology 2019Quote: ... Bronchial Air Liquid Interface B-ALI media (Lonza), Small airway epithelial cell media and detach kit (PromoCell) ...
-
bioRxiv - Immunology 2022Quote: B cell lines were cultured in RPMI (Lonza) + 10% foetal calf serum (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Gentamicin/Amphotericin-B-1000 (#CC-4081C; Lonza). All cells were kept at 37 °C and 5% CO2 ...
-
bioRxiv - Biophysics 2023Quote: ... and 0.25 µg/ml amphotericin B (Lonza, Basel). Primary eye primordia explants are dissected from Xenopus laevis embryos as previously described (47) ...
-
bioRxiv - Immunology 2023Quote: ... 1% penicillin-streptomycin-Amphotericin B (17-754E, Lonza), 0.2% Primocin (Invivogen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Dulbecco's Modified Eagle Medium (Lonza, Ref BE12-614F) throughout the study ...
-
bioRxiv - Cell Biology 2023Quote: ... high glucose Dulbecco’s Modified Eagle Medium (DMEM, Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... or Dulbecco’s Modified Eagle Medium (DMEM, Lonza, UK) was used to wash the marrow repeatedly until any bone was white ...
-
bioRxiv - Bioengineering 2023Quote: ... or Dulbecco’s Modified Eagle Medium (DMEM, Lonza, UK) was added to the universal tube of marrow and shaken vigorously to extract the HBMSCs ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). This line was provided by the Thomson lab and assayed for standard pluripotency markers and had a normal karyotype (supplemental figure 1) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and gentamicin/amphotericin B (FGM-2; singlequots; Clonetics/Lonza). At 80% confluency ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CC-2540S) and cultured in B-ALI medium (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% penicillin/streptomycin/amphotericin B (Lonza, Walkersville, MD). Afterward ...
-
bioRxiv - Immunology 2020Quote: ... solution DMEM (Lonza) solution ...
-
bioRxiv - Biochemistry 2020Quote: ... in Dulbecco’s Modified Eagle’s Medium (DMEM; Lonza, Slough, UK) supplemented with 5% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Lonza. DMEM-F12 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellet was resuspended in Iscove’s modified Dulbecco medium (Lonza) supplemented with 2% fetal calf serum and 50 U/ml penicillin ...
-
bioRxiv - Immunology 2020Quote: ... Cells were incubated in Isocove’s Modified Dulbecco’s Medium (Lonza) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were grown in Dulbecco’s modified Eagle’s medium (Lonza) with 2 mM L-glutamine ...
-
bioRxiv - Bioengineering 2023Quote: ... Dulbecco’s Modified Eagle’s Medium (DMEM) was purchased from Lonza Chemicals ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAL27 (Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, #12-614Q) with 10% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the B-016 program of the 4D-Nucleofector (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated B-cells were kept on ice in DMEM (Lonza) supplemented with 0.6% BSA (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was more than 99% with an endotoxin concentration lower than 2 units/mg protein by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza; Walkersville, MD).
-
bioRxiv - Cancer Biology 2022Quote: ... with high glucose-containing Dulbecco’s Modified Eagle Medium (DMEM; Lonza) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... in Dulbecco’s modified Eagle Medium (DMEM) (Biowhittaker® Reagents, Lonza). For primary rat fibroblasts ...
-
bioRxiv - Microbiology 2021Quote: ... were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Lonza, Switzerland) supplemented with 10% (vol/vol ...
-
bioRxiv - Genomics 2019Quote: ... using SF solution (Lonza) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... in Solution V (Lonza), using program A-023 on an Amaxa nucleofector ...