Labshake search
Citations for Lonza :
1 - 50 of 103 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... which directly correlates to cellular metabolic activity.46 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Systems Biology 2020Quote: ... amphotericin B (Lonza 17-836E), and gentamicin (Lonza 17-518 ...
-
bioRxiv - Physiology 2022Quote: ... Amphotericin-B (CC-4081C, Lonza), ascorbic acid (CC-4116C ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Amphotericin B (17-936E, Lonza). YUMM1.7 cells were cultured in DMEM/F-12 medium with L-Glutamine and 15mM HEPES (11330 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and with Pen/Strep Amphotericin B (Lonza) in an atmosphere of 95% air and 5% CO2 at 37°C.
-
bioRxiv - Bioengineering 2020Quote: ... and gentamicin/amphotericin-B (Lonza, Walkersville, MD). MSCs were cultured in low glucose DMEM and L-glut media ...
-
bioRxiv - Molecular Biology 2023Quote: ... A nucleofector II-b device (Amaxa, Lonza), program A-30 with 10 µg of plasmid DNA and 1 µg of eGFP control plasmid (Amaxa ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer’s instructions (Lonza) at a concentration of 4 - 5 × 106 cells / 86 μL ...
-
bioRxiv - Immunology 2019Quote: ... Bronchial Air Liquid Interface B-ALI media (Lonza), Small airway epithelial cell media and detach kit (PromoCell) ...
-
bioRxiv - Immunology 2022Quote: B cell lines were cultured in RPMI (Lonza) + 10% foetal calf serum (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Gentamicin/Amphotericin-B-1000 (#CC-4081C; Lonza). All cells were kept at 37 °C and 5% CO2 ...
-
bioRxiv - Biophysics 2023Quote: ... and 0.25 µg/ml amphotericin B (Lonza, Basel). Primary eye primordia explants are dissected from Xenopus laevis embryos as previously described (47) ...
-
bioRxiv - Immunology 2023Quote: ... 1% penicillin-streptomycin-Amphotericin B (17-754E, Lonza), 0.2% Primocin (Invivogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). This line was provided by the Thomson lab and assayed for standard pluripotency markers and had a normal karyotype (supplemental figure 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).
-
bioRxiv - Evolutionary Biology 2022Quote: ... and gentamicin/amphotericin B (FGM-2; singlequots; Clonetics/Lonza). At 80% confluency ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CC-2540S) and cultured in B-ALI medium (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% penicillin/streptomycin/amphotericin B (Lonza, Walkersville, MD). Afterward ...
-
bioRxiv - Biophysics 2021Quote: ... containing AMUPol and electroporated (HEK293 pulse sequence, Lonza 4D-nucleofactor) using manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... containing AMUPol and electroporated (HEK293 pulse sequence, Lonza 4D-nucleofactor) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The IFNα-RBD sequence was then cloned into the PEE12.4 (Lonza) with a human IgG1 Fc ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the B-016 program of the 4D-Nucleofector (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated B-cells were kept on ice in DMEM (Lonza) supplemented with 0.6% BSA (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2019Quote: ... and 1% penicillin-streptomycin-amphotericin B solution (Lonza, Walkersville, MD, USA). Cells were grown on Matrigel (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... All media contained 1% Penicillin-Streptomycin-Amphotericin B mixture (Lonza, Switzerland) as well ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% NEAA and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). For feeder-free culture ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ml Penicillin-Streptomycin-Amphotericin B Mixture (PSF, Lonza 17-745E)) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10% FBS and Gentamicin/Amphotericin B (FGM-2, singlequots, Clonetics/Lonza); cells were divided before reaching 80% confluency ...
-
bioRxiv - Immunology 2022Quote: ... B cells were cultured with RPMI-1640 medium (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... Nucleotide sequences were synthesized by GeneArt and subcloned into expression vector pEE6.4 (Lonza) for expression.
-
bioRxiv - Genomics 2019Quote: ... HAFTL pre-B cells were cultured in RPMI1640 without phenol red (Lonza) supplemented with 10% charcoal/dextran-treated FBS (Hyclone ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: All coding sequences used in this study were cloned into pmax expression vector (Lonza) by TEDA as previously reported (46) ...
-
bioRxiv - Immunology 2019Quote: ... HAE cultures were grown in B-ALI medium supplemented with inducer (Lonza Inc.) at each media change with provision of an air-liquid interface for approximately 6 weeks to form differentiated ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nucleofection was performed with program B-016 on an Amaxa Nucleofector II (Lonza). Cells were then grown for ten days under selection by 1 μg/mL puromycin and 10 μg/mL blasticidin ...
-
bioRxiv - Biophysics 2023Quote: ... 100 units/ml penicillin-streptomycin and 0.25 µg/ml amphotericin B (Lonza, Basel) are added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1 μg/mL amphotericin B (Biowest) and 10,000 U/mL penicillin/streptomycin (Lonza). Cells and PDECs were grown in a humidified incubator at 37◦C under 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using the Amaxa Nucleofector kit V program B-023 (Lonza) or Xcell PBS protocol ...
-
bioRxiv - Genetics 2023Quote: Plasmids were transfected using either the 4D Nucleofector (EBV B, Daudi, THP1; Lonza, 4D-Nucleofector Core Unit #AAF-1002B and 4D-Nucleofector X Unit #AAF-1002X) ...
-
bioRxiv - Cell Biology 2021Quote: The A20 B-cell lymphoma line (ATCC #TIB-208) was cultured in DMEM (Lonza) supplemented with 10% of FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Sorted B cells were cultured for 4 days in RPMI 1640 with UltraGlutamine (Lonza) containing 10% FBS (Dominique Dutscher) ...
-
bioRxiv - Immunology 2021Quote: ... 10,000μg/ml streptomycin and 25μg/ml amphotericin B (Fungizone) (PSF; Lonza, Walkersville, MD, USA). The following day ...
-
bioRxiv - Neuroscience 2022Quote: ... The nucleofection was performed using an Amaxa Nucleofector II (Lonza Bioscience, program B-016). After selection with 1 μg/ml puromycin ...
-
bioRxiv - Physiology 2022Quote: ... and 2.5 μg/mL amphotericin B in Hank’s balanced salt solution (HBSS) (Lonza, UK). It was then finely minced and digested overnight on a rocker at 4 °C in 1 mg/mL protease XIV (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Immunology 2019Quote: ... B cells were cultured for 2 to 4 days in RPMI 1640 with UltraGlutamine (Lonza) containing 10% fetal calf serum (FCS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human bronchial epithelial (NHBE)-Bronchial Epi Cells for B-ALI from Lonza (CC-2540S) were cultured in PneumaCult-Ex Plus Medium (StemCell ...
-
bioRxiv - Bioengineering 2020Quote: Bone marrow derived human mesenchymal stem cells (BM-hMSCs) (24yr old B female, Lonza, Switzerland) were used at passage 4 – 6 and cultured with complete hMSC media containing low glucose Dulbecco’s Modified Eagle Medium and glutamine (School of Chemical Sciences Cell Media Facility ...