Labshake search
Citations for Lonza :
1 - 50 of 533 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Bioengineering 2020Quote: ... cells were washed with 5 mL of 1X-phosphate buffered saline without magnesium and calcium (PBS) (Lonza) and supplemented with fresh DMEM-HEPES supplemented with 10 mM sodium butyrate (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Cell Biology 2021Quote: ... calcium-free medium designed for epithelial cell growth (Lonza). In the growth medium-KGM Gold mix (at a 1:4 dilution) ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
Red Algae-Derived Mineral Intervention to Counter Pro-inflammatory Activity in Human Colon OrganoidsbioRxiv - Molecular Biology 2022Quote: ... calcium-free culture medium optimized for epithelial cell growth (Lonza). The final serum concentration in the L-WRN – KGM Gold culture medium was 2.5% and the calcium concentration was 0.25 mM ...
-
bioRxiv - Immunology 2020Quote: ... Nucleotide sequences were synthesized by GeneArt and subcloned into expression vector pEE6.4 (Lonza) for expression.
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Immunology 2022Quote: ... the cells were resuspended in HBSS without Calcium and Magnesium (Lonza). 5 μM Fluo-8 AM (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Wells were washed with 1x sterile PBS (without calcium or magnesium, Lonza) and cells incubated 30 min with DMEM (- pen - strep) ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1x phosphate buffered saline without calcium or magnesium (1x PBS; Lonza) were also used as provided ...
-
bioRxiv - Physiology 2022Quote: ... 0.1% NaN3 Dulbecco’s Phosphate Buffered Saline (DBPS) without Calcium and Magnesium (Lonza). Cells were resuspended in 4 mL of FACS buffer for cell counting ...
-
bioRxiv - Biophysics 2024Quote: ... phosphate buffered saline (PBS) without calcium and magnesium was purchased from Lonza.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were washed with Dulbecco’s phosphate buffered saline without calcium or magnesium (DPBS, Lonza) and treated with 4% Formaldehyde in PBS (PFA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed in chelating buffer [calcium and magnesium-free Hank’s balanced salt solution (HBSS, Lonza) containing 0.5mM ethylene glycol tetraacetic acid (EGTA) ...
-
bioRxiv - Genomics 2023Quote: ... washed once with calcium- and magnesium free phosphate buffered saline (PBS, Lonza # BE17-516F), and resuspended in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed with Dulbecco’s phosphate buffered saline without calcium or magnesium (DPBS, Lonza) and treated with 4% formaldehyde in PBS (PFA ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Microbiology 2020Quote: ... in Dulbecco’s phosphate-buffered saline lacking magnesium or calcium (DPBS, Lonza America, Inc.; Alpharetta, GA).
-
bioRxiv - Immunology 2023Quote: ... Cells enriched by Percoll density-dependent sedimentation were adjusted to a concentration of 1 × 106 cells/ml in serum-free X-VIVOTM 15 medium (Lonza BioWhittaker) containing 100 ng/ml recombinant human SCF (Peprotech ...
-
bioRxiv - Cancer Biology 2021Quote: Mitochondria-targeted calcium construct 4mtGCamp6f was electroporated into cells with with Amaxa Nucleofactor (Lonza, Basel, Switzerland). Cells were allowed to recover in full IMDM media for 24 hours and then plated on poly-D lysine covered slides ...
-
bioRxiv - Bioengineering 2024Quote: ... 1x phosphate buffered saline (PBS) solution without calcium or magnesium was obtained from Lonza (MD, USA). HLFs were cultured in treated tissue culture flasks with fibroblast media supplemented with 2% FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All of the cell lines were confirmed by single-nucleotide-polymorphism array and short-tandem-repeat authentication (Genetica DNA Laboratories) and routinely tested negative for mycoplasma (MycoAlert, Lonza)
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Antibodies which contained endotoxin levels above 3 EU/ml (Kinetic-QCL Kinetic Chromogenic LAL Assay, Lonza) were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript ...
-
bioRxiv - Bioengineering 2023Quote: ... 1x phosphate-buffered saline (1x PBS, 150 mM salt, without calcium or magnesium) was purchased from Lonza. 4– 20% Mini-PROTEAN® TGX Stain-Free™ Gel-15 well ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Lymph nodes were placed in ice-cold DPBS without calcium or magnesium (Lonza, Walkersville MD, USA, #17-512F) supplemented with 2 % heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell cultures were washed with Dulbecco’s phosphate buffered saline without calcium or magnesium (DPBS-; Lonza, Walkersville, MD, USA) and detached with 0.25% trypsin with 0.53 mM EDTA (ATCC ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Bioengineering 2020Quote: ... scaffolds were coated through submersion for 4h at 37°C and thoroughly washed with phosphate buffered saline (PBS without calcium and magnesium, Lonza). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... and then changed to low calcium basal keratinocyte medium supplemented with SingleQuots (bovine pituitary extract, hydrocortisone, and epidermal growth factor) (Lonza Corporation). After 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... The latter prints were post-treated by soaking in sterile 1x phosphate-buffered saline without calcium and magnesium (PBS, Prod. No. 17-516F, Lonza, USA) for 24 hours at 37°C for BV007a or at 50°C (BioMed and Clear resins ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... PBMCs were isolated from whole blood that was diluted with an equal volume of Dulbecco’s Phosphate Buffered Saline without calcium or magnesium (DPBS; Lonza; 17-512F). Diluted whole blood was layered onto an equal volume of HISTOPAQUE-1077 (Sigma ...
-
bioRxiv - Microbiology 2023Quote: Colons from infected mice were open longitudinally and gently washed with ice-cold 1X PBS before being placed in Hanks’ balanced salt solution (HBSS) with phenol red and without calcium and magnesium (Lonza, Basel, Switzerland) on ice ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...