Labshake search
Citations for Lonza :
1 - 50 of 62 citations for CYB5A siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 4 μM of each siRNA (TriFECTa® RNAi Kit, IDT) or negative control siRNA (Universal Negative Control siRNA [Nippon Gene]) by nucleofection (Lonza) using reagent V and the X-001 program ...
-
bioRxiv - Neuroscience 2019Quote: ... Ganglionic eminences and cortex were dissected and dissociated cortical neurons were nucleofected with ON-TARGET plus mouse Mecp2 siRNA or Non-targeting siRNA 1 (Dharmacon) according to the protocol of Amaxa Nucleofection (Lonza). Then neurons were plated into microchambers coated with poly-D-lysine (0.1 mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... was performed by nucleofection of primary cDCs isolated from HD with specific siRNAs (SMART-pool, Horizon Discovery) or irrelevant scramble siRNA in an Amaxa4D-Nucleofector (Lonza) instrument using the CM120 protocol and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... siRNA against human genes or control siRNA were incubated with a mixture of nucleofection solution (Human Monocytes Nucleofector kit; Lonza) and primary human monocytes and placed in nucleofection cuvettes subjected to program Y-010 for the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... Jurkat T cells were transfected with ON-TARGETplus SMARTpool human Piezo1 siRNA or control siRNA (Horizon Discovery, previously Dharmacon) with SE Cell Line 4D-Nucleofector™ X Kit (Lonza). Jurkat T cells were used for the experiment after 24 h.
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Transient siRNA transfections were performed using Amaxa kits C (Amaxa Lonza) for CEM.NKR-CCR5 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... siRNAs were transiently transfected into NB cells using Nucleofector electroporation (Lonza): solution L and program C-005 for IMR32 and IMR5 ...
-
bioRxiv - Immunology 2021Quote: Transfection of siRNA was carried out using the 4D Nucleofector (Lonza) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs were transiently transfected into NB cells using Nucleofector electroporation (Lonza): solution L and program C-005 for IMR32 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids and siRNAs were then transfected with a 4D-Nucleofector (Lonza) using program EI-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... control- or REST-siRNA transfected as described earlier (Dharmacon, Lonza, and Invitrogen). 500 ng of RNA was used for cDNA synthesis for transcriptome sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... siRNA was transfected with Amaxa cell line nucleofector kit and Nucleofector II (Lonza) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... CAF siRNA transfections were performed by nucleofection using the Amaxa kit R (Lonza) and downstream experiments were performed 5 days post transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection of siRNAs into BMMCs was performed using the Amaxa Nucleofector Kit T (Lonza). BMMCs were pelleted and resuspended at a concentration of 2×106 cells/100 μL Nucleofector T solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with Dharmacon ON-TARGETplus siRNAs using the Amaxa Nucleofector system (Lonza).
-
bioRxiv - Immunology 2023Quote: ... HUVEC were nucleofected (AMAXA) with siRNAs (100pmol) using HUVEC transfection reagent (VPB-1002, Lonza). Cells were used 48h after transfection.
-
bioRxiv - Cell Biology 2021Quote: Astrocytes were transfected with siRNAs (1-5nM) or plasmids (5µg) using a Nucleofector machine (Lonza) and the appropriate Lonza glial cell nucleofector solution ...
-
bioRxiv - Cell Biology 2023Quote: ... Transient expression of cDNAs or siRNAs was performed using the Amaxa nucleofector kit R (Lonza) and Amaxa Nucleofector II (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: All siRNA and plasmid transfection experiments in PC3 cells were performed using nucleofection (Lonza-kit V)(see supplementary information for details) ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfection in primary melanocytes was done using Nucleofection Kit (Lonza, VPD-1003, U-024 program) (Sultan et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids and siRNAs were introduced into chromaffin cells (5 × 106 cells) by Amaxa Nucleofactor systems (Lonza) according to manufacturer’s instructions and as described previously [46] ...
-
bioRxiv - Cell Biology 2019Quote: ... SKBr3 were co-transfected with cDNA and siRNA by electroporation using Amaxa Nucleofector (kit V, Lonza AG). Cell lysate were collected 48 to 72 hours later ...
-
bioRxiv - Immunology 2021Quote: ... and transfected with siGenome SMARTpool small interference RNA (siRNA) oligonucleotides (Dharmacon) using the nucleofection technique by Lonza. Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’ ...
-
bioRxiv - Microbiology 2023Quote: siRNAs targeting bovine hnRNPM were introduced into BL3.1 cells using Amaxa cell line Nucleofector kit V (Lonza) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... siRNAs (1 μg per ml) were nucleofected into ISE6 cells using the 4D-Nucleofector System (Lonza Bioscience). Tick cells were centrifuged at 100 x g for 10 minutes to pellet the cells ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA molecules were electroporated into isolated postnatal cerebellar granule cells using the Nucleofector 2b Device (Lonza, AAB-1001) as previously described (Gartner et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza, Basel, Switzerland) using the CA-152 protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... A non-targeting siRNA sequence (ntRNA; Dharmacon) was used as control and co-transfection with pmaxGFP (Lonza, Switzerland) was performed in all cases for transfected neurons identification ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... the siRNAs were transfected into human CD4+ T cells using the Amaxa Nucleofector following the manufacturer’s protocols (Lonza). The siRNAs used in this study were purchased from GenePharma and the sequences are as below:
-
bioRxiv - Neuroscience 2022Quote: ... A non-targeting siRNA sequence (ntRNA; Dharmacon) was used as control and co-transfection with pmaxGFP (Lonza, Switzerland) was performed in all cases for transfected neurons identification ...
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: RPE-1 cells were transfected with 20 pmol siRNA by nucleofection (Amaxa Lonza 4D program EA-104 P3 solution) or Lipofectamine RNAiMAX transfection reagent (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... Cells were transfected with 250 nM of siRNA and 1 μl of control pMax GFP (Nucleofector X kit, Lonza), using the CU-133 program ...
-
bioRxiv - Cancer Biology 2020Quote: ... ON-TARGETplus non-targeting siRNA#2) were used for transient RNA interference experiments and transfected using Nucleofector technology (Lonza).
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... dissociated neurons were electroporated with cDNA (2 µg) or siRNA (Table S1) using an Amaxa nucleofector (program-005, Lonza) and mouse neuron nucleofectorTM kit (VPG-1001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ki-67 depletion was performed by nucleofection with an siRNA against mouse Ki-67 (CGUUGAUAUCAGCAACUUU) using Amaxa Nucleofector (Lonza), in accordance with the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... 400 pmol of siRNA duplex was introduced into 3.0 × 106 cells using the Cell Line 96-well Nucleofector Kit SF (Lonza) with program DG150 of the 96-well Shuttle Device (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP168LV (XP-C patient cells) were transfected with siRNAs and subsequently serum starved for at least 24 hrs in F10 medium (Lonza) supplemented with 0.5% FCS and antibiotics ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated by CD3/CD28 Abs for 2 days and nuclofected with 100 μM RORC or non-targeting (NT1) siRNA (ON-TARGETplus SMART pool, Dharmacon) using the Amaxa Human T cell Nucleofector Kit (Amaxa, Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 x 106 cells of MEFs were transfected with 1.2 nM of siRNAs using Amaxa Nucleofector II (Lonza, Basel, Switzerland) and MF 1 Nucleofector kit (Lonza ...