Labshake search
Citations for Lonza :
1 - 50 of 1927 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (Lonza) and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2022Quote: ... non-essential amino acids (1×, Lonza), penicillin (100 IU/mL) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% non-essential amino acids (Lonza), 2mM L-glutamine (200mM ...
-
bioRxiv - Bioengineering 2023Quote: ... were expanded to passage 6 or 7 in endothelial growth media (EGM-2 BulletKit, Lonza), and culture medium was changed every other day ...
-
bioRxiv - Genomics 2020Quote: ... 1% non-essential amino acid solution (Lonza), and 1% antibiotic-antimycotic solution (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1× non-essential amino acids (Lonza) at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... 1% Non-Essential Amino Acid Solution (Lonza), 1% Sodium Pyruvate (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% non-essential amino acids (Lonza) at 37 °C in a 5% CO2 humidified environment.
-
bioRxiv - Genomics 2020Quote: ... and 1% non-essential amino acid solution (Lonza) at 37°C in a humidified atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 1% non-essential amino acids (Lonza BE13-114E), 0.2 mM myoinositol (Sigma I7508) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 52 years-old; non-CF donor #2: WT-AB0834, male, 71 years-old; non-CF donor #4: CC-2540S-20TL256517, Lonza, female, 48 years-old). After co-incubation with correctors for 24 h in medium (MucilAir™ medium ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Physiology 2020Quote: ... supplemented with non-essential amino acids (1%, 100x Lonza), sodium-pyruvate (1% ...
-
bioRxiv - Immunology 2021Quote: ... 1% (v/v) non-essential amino acids (NEAA) (Lonza), 2mM L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) MEM non-essential amino acids (Lonza), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 1% 100x non-essential amino acid (Lonza #13-144E), 100 mM sodium pyruvate (Lonza #13-115E) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1% non-essential amino acids mixture (NEAA; Lonza). Cells were harvested using trypsin/EDTA ...
-
bioRxiv - Neuroscience 2020Quote: ... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ...
-
bioRxiv - Microbiology 2022Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: One straw of passage 4 HUVECs (Lonza, USA) was thawed in a 35mm dish and cultured in EGM-2 medium until almost 80% confluence is reached ...
-
bioRxiv - Biochemistry 2019Quote: ... at passages 4-7 were grown to confluence on gelatin-coated plates and maintained using complete EGM-2 media (Lonza). HKi002 was maintained at room temperature for 30 min rotating before use ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... non-CF#4 (CC-2540S -20TL356517, Lonza, female, 48 years-old). hAEC cells were cultured for several days until reaching 90-95% confluency in complete PneumaCultExPlus medium ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Ultraglutamine 1 (Lonza) and 1× MycoZap antibiotics (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... 1% non-essential amino acids and 10% fetal bovine serum (Lonza, NJ, USA). The media for ER+ cell lines were further supplemented with insulin (0.1 µg/ml) ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... supplemented with Ultraglutamine-1 (4 mM; Lonza) and antibiotic-antimycotic (1% ...
-
bioRxiv - Developmental Biology 2021Quote: Passage 1-6 human umbilical vein endothelial cells (HUVEC, Lonza) were cultured in 0.003% Endothelial cell growth supplement (Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Bioengineering 2023Quote: Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... MSCs (2×104 in 6 μl, Lonza, UK) were injected in DMM operated mice at 14 weeks following the surgery ...
-
bioRxiv - Immunology 2020Quote: ... diluted 1:100 in EBM-2 (Lonza). Cells were used for experiments within 3-5 passages ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Immunology 2023Quote: ... and cells were harvested on day 7 using 1 X PBS EDTA (Lonza, BE02-017F) for experiments.
-
bioRxiv - Systems Biology 2019Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Systems Biology 2021Quote: ... and routinely passaged every 4∼6 days with Versene (EDTA) solution (Lonza). Selected iPSC clones were further validated for expression of pluripotency markers with immunostaining (Supplementary Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... and routinely passaged every 4~6 days with Versene (EDTA) solution (Lonza). Selected iPSC clones were further validated for expression of pluripotency markers with immunostaining (Chen et al. ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Bioengineering 2022Quote: ... were used in passage 2 to 6 and were cultivated in Endothelial Cell Growth Medium-2 (EBM-2 medium supplemented with EGM-2 SingleQuots supplements, Lonza).
-
bioRxiv - Microbiology 2021Quote: Primary human bronchial epithelial cells (HBECs) derived from a non-smoking donor (Cat# CC-2540, male; Lonza; Donor 1) or derived directly from a patient at Cambridge University Hospitals NHS Trust (Research Ethics Committee Reference 19/SW/0152 ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
bioRxiv - Genetics 2019Quote: ... Between 1×10^4 – 5×10^4 cells per condition were resuspended in 20μl of Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the Cas9 gRNA RNP complex ...
-
bioRxiv - Neuroscience 2019Quote: ... Ganglionic eminences and cortex were dissected and dissociated cortical neurons were nucleofected with ON-TARGET plus mouse Mecp2 siRNA or Non-targeting siRNA 1 (Dharmacon) according to the protocol of Amaxa Nucleofection (Lonza). Then neurons were plated into microchambers coated with poly-D-lysine (0.1 mg/ml ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... HUVECs were prepared in 6-well plates with 2.8.105 cells/well in EGM-2 medium (Endothelial Cell Growth Medium-2, Lonza). Cells were transduced in duplicate with 20 MOI (Multiplicity of Infection ...