Labshake search
Citations for Lonza :
1 - 50 of 498 citations for 3 methy 5 isobutylhydantion since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 μg of pmaxGFP plasmid (Lonza) was added to transfection mixes to monitor transfection efficiency ...
-
bioRxiv - Genomics 2019Quote: ... The DNA fragments of 150–200 bp length were gel-extracted on 3% NuSieve 3:1 Agarose (Lonza). Both samples were sequenced by GATC Biotech AG (Konstanz ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Cell Biology 2019Quote: ... and separated on a 3% MetaPhor gel (Lonza).
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% CO2 in EGM1 (Lonza) on 1% gelatin-coated flasks (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... 5 mM L-Glutamine (Lonza), and 1% penicillin and streptomycin (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% CO2 in DMEM (Lonza) with 10% FBS (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Medium containing 5% FCS (Lonza) was used to expand and grow cells in a Cell Factory (6320 cm2 ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% decomplemented FBS (Lonza), 1 M HEPES (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with horse serum (5%, Lonza), recombinant human insulin (5 ug/mL) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μg/ml laminin (Lonza), and cultured in DMEM high glucose medium (Nacalai ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... insulin and 3% fetal bovine serum (FBS) (Lonza, #CC-4123). MO3.13 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were maintained in FGM-3 Medium (CC-4526, Lonza) and passaged at 80% confluence.
-
bioRxiv - Microbiology 2022Quote: Sterile molten top NA (3 mL; 0.2 % SeaPlaque Agarose, Lonza) supplemented with CaCl2 and MgCl2 (both at 5 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza). 150 μm thick vibratome sections (VT1000S vibratome ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza) and vibratome-sectioned (VT1000S vibratome ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Microbiology 2021Quote: ... in Pro-CHO-5 media (Lonza, Switzerland).
-
bioRxiv - Neuroscience 2021Quote: ... and 5 U ml−1 Penstrep (Lonza). Hb9-GFP mouse stem cells were cultured as described (Wichterle et al ...
-
bioRxiv - Immunology 2021Quote: ... 5% CO2 in X-VIVO 15 (Lonza) supplemented with 5% (v/v ...