Labshake search
Citations for Lonza :
8801 - 8850 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Low basal expression and slow induction of IFITM3 puts immune cells at risk of influenza A infectionbioRxiv - Immunology 2019Quote: PBMCs were cultured in RPMI (Lonza) while HEK293 and A549 cells were cultured in DMEM (Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: Cell culture: Glut1 experiments were done on HEK293 (ATCC #CRL-1573) cells transfected using the Amaxa system (Lonza) and 1 µg DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Amaxa Nucleofector I system (Lonza). For EPs with Neon Transfection System ...
-
bioRxiv - Cancer Biology 2019Quote: HUVECs (Lonza, Walkersville, MD) were cultured with EGM-2 medium (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... were cultured with EGM-2 medium (Lonza), and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 75 ng of these substrates were electroporated into 200,000 cells with 1 ug of pMAX-GFP (Lonza) using the Neon system (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... which consisted of: Medium 199 (Lonza), 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Microbiology 2019Quote: ... NHLF (LONZA) and HUVEC (LONZA) ...
-
bioRxiv - Microbiology 2019Quote: ... and HUVEC (LONZA). These cell lines were mycoplasma tested and authenticated by PCR using human 16-marker short tandem repeat profiling and interspecies contamination test by IDEXX (Columbia ...
-
bioRxiv - Molecular Biology 2019Quote: ... in a 1:200 ratio using a 4D-Nucleofector (Lonza). Cells were transfected with 2.26µg total plasmid DNA in SF buffer (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transfected with 2.26µg total plasmid DNA in SF buffer (Lonza, V4SC-2096), using program CM134 and incubated for 24 hours prior to luminescence measurement ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 10% FBS (HyClone) and routinely tested for mycoplasma contamination using MycoAlert (Lonza).
-
bioRxiv - Cancer Biology 2019Quote: ... All cells were authenticated by short tandem repeat analysis and confirmed negative for Mycoplasma infection with the MycoAlert Mycoplasma Detection Kit (Lonza). HCT-116 and A549 cells were cultured in DMEM ...
-
bioRxiv - Biochemistry 2019Quote: ... Sf21 cells (2 × 106 cells mL−1) were infected with the P3 viral stock in Insect-XPRESS protein-free medium (Lonza). The infected insect cells were grown at 27 °C with shaking for 66 hours ...
-
bioRxiv - Microbiology 2019Quote: ... RPTE cells were grown in renal epithelial basal media enriched with REGM bullet kit (Lonza). RPTE cells were used at passage 6-7 for all experiments.
-
bioRxiv - Microbiology 2019Quote: ... 3 µl of the labeled culture was spotted on glass cover slide and covered with 1.5 % (w/v) SeaKem LE agarose (Lonza) pad in water and visualized by epifluorescence microscopy ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... using the MycoAlert PLUS assay kit from Lonza, and were authenticated by short tandem repeat profiling ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary human melanocytes were grown in proliferative conditions in PMA containing medium MBM4 (Lonza). For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were confirmed to be mycoplasma negative via MycoAlertTM Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were tested biweekly during experiments using a mycoplasma detection kit to confirm absence of mycoplasma contamination using the Lonza MycoAlert® (Lonza #LT07-318). HCC1806 cells were grown in RPMI 1640 Medium (Life Technologies #11875093 ...
-
bioRxiv - Immunology 2019Quote: ... thymic lobes were embedded in 4% agarose with low melting temperature (GTG-NuSieve Agarose, Lonza) before being sectioned into 200-400□m slices using a vibratome (1000 Plus sectioning system ...
-
bioRxiv - Immunology 2019Quote: ... and red blood cells lysed in 1ml ammonium chloride (ACK buffer, Lonza UK) for 1 minute at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... Cells were washed and resuspended at 2.5×106/ml in R5 medium (RPMI 1640, Lonza, Switzerland), 5% heat-inactivated FBS (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were nucleofected using the Human Stem Cell Nucleofector® Kit 2 (Lonza, VPH-5022) in combination with the AMAXA-2b nucleofector ...
-
bioRxiv - Bioengineering 2019Quote: ... human BM-MSC were obtained from consenting donors undergoing therapeutic MSC and cultured for three to seven passages in supplemented αMEM (Minimal Essential Medium, Lonza, USA). Hemi-larynges were seeded in dedicated bioreactors at a seeding density of 1.5×106/cm2.
-
bioRxiv - Bioengineering 2019Quote: ... sterilised scaffolds were place in Bronchial Epithelial Growth Medium (BEGM BulletKit, Lonza CC-3170, USA) in customised bioreactors ...
-
bioRxiv - Cancer Biology 2019Quote: Primary normal human astrocytes (NHAs) were purchased from Lonza (#CC-2565). Immortalized human oligodendrocyte MO3.13 cells were a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2019Quote: ... NHAs were used within one passage and maintained in astrocyte growth medium (AGM, Lonza #CC-3187) supplemented with L-glutamine ...
-
bioRxiv - Cancer Biology 2019Quote: ... insulin and 3% fetal bovine serum (FBS) (Lonza, #CC-4123). MO3.13 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and resuspended in 500 µL of Zymolyase buffer (NZ buffer with 20T zymolyase) and 500 µL LMP 2% (SeaKem LE agarose, Lonza, ref# 50001). Homogenized pellets were poured into the plug molds (∼100 µl/plug ...
-
bioRxiv - Physiology 2019Quote: ... 10% AIM-V and 100 units/ml penicillin/ streptomycin and transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) or magnetofection with PolyMag Neo magnetic beads (OZ Biosciences) ...
-
bioRxiv - Physiology 2019Quote: ... Hermes 2b cells were transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... (Lonza, CAT#12001-798, 10,000x concentrated) incubated at 4° overnight collected via centrifugation and resuspended in 150 µL 50:50 TE ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell lines were confirmed mycoplasma negative using Mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Neuroscience 2019Quote: ... After 3 to 4 passages cell were electroporated via Nucleofection with the AMAXA nucleofection device (LONZA). The Neurospheres were dissociated with Accutase (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... and 100 mg ml-1 streptomycin (Biowhittaker-Lonza). Cells were maintained at 37 °C in a 5 % CO2 humidified atmosphere ...
-
bioRxiv - Cell Biology 2019Quote: 4D-Nucleofector (units AAF-1002B, AAF-1002X, Lonza)
-
bioRxiv - Cell Biology 2019Quote: 4D-Nucleofector® X Kit (product V4XC-1032, Lonza)
-
bioRxiv - Cancer Biology 2019Quote: ... All cells tested negative for Mycoplasma contamination using the MycoAlert Plus Mycoplasma detection kit from Lonza. AstraZeneca licensed the CDK9 inhibitor (AZD5576 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were cultured in phenol red free XVivo-10 media (Lonza) supplemented with 10units/ml IL-2 ...
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: The siRNA knockdown was performed by electroporation using the Amaxa nucleofector I in combination with the Amaxa Cell Line Nucleofector Kit V (Lonza, VCA-1003). SiRNA constructs with the siRNA cloned in the pLKO.1-Puro vector were obtained from the MISSION shRNA library (Sigma product SHGLY) ...
-
bioRxiv - Immunology 2019Quote: ... in RPMI medium (Lonza) supplemented with 2% FCS and 1mg/mL dispase II (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Animals were sacrificed by cervical dislocation four days after electroporation and resected xenografts were fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Lonza, Basel, Switzerland) at 4°C for approximately one week ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 1% antibiotics (penicillin and streptomycin; Lonza) and 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Molecular Biology 2019Quote: ... These cells were cultured in DMEM (Lonza), supplemented with 1% antibiotics (penicillin and streptomycin ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 1% antibiotics (penicillin and streptomycin; Lonza) and 10% fetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2019Quote: Wild type SV40-immortalized human fibroblasts (MRC5) were cultured in a 1:1 mixture of Ham’s F10 and DMEM (Lonza) supplemented with 1% antibiotics (penicillin and streptomycin ...
-
bioRxiv - Genomics 2019Quote: ... TetO-CDC6 mESCs were cultured on 0.1% gelatin-coated plates in Dulbecco’s modified Eagle’s medium (DMEM) with Ultraglutamine 1 and 4.5 g/L glucose (Lonza) supplemented with 15% FBS (Sigma) ...