Labshake search
Citations for Lonza :
451 - 500 of 1956 citations for Mouse Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing using the MycoAlert detection kit (Lonza, Ben OR) was performed every 2 months ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma infection monitoring was performed using MycoAlert Detection Kit (Lonza) and only mycoplasma-free cultures were used.
-
bioRxiv - Cancer Biology 2021Quote: ... based on routine testing with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were screened for mycoplasma with MycoAlert detection kit (Lonza) at receipt or thaw ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in a supplemented (EGM-2 bullet kit, Lonza) endothelial cell growth medium (Lifeline Cell Technology ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... and supplemented with EGM-2 bullet kit (Lonza, CC-3162). HUVEC were seeded on 0.5% gelatin-coated 6-well plates at a density of 1.5 x105 cells/well overnight ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were screened for mycoplasma (MycoAlert kit, Lonza, Basel, Switzerland). HCI-10 PDX tumor fragments were provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... and Amaxa P3 Primary Cell kit L (Lonza, V4XP-3012), program CB-150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... UWB1.289PT in the 50% RPMI-1640 (Gibco™)/ 50% MEGM (MEGM Bullet Kit; CC-3150, Lonza, Basel, Switzerland) supplemented with 3% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... Mycoplasma testing was conducted using the MycoAlert Detection Kit (Lonza). Cells were cryopreserved using complete growth media containing 5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the SE Cell Line 4D Nucleofector X Kit (Lonza) and program EN-104 was used for nucleofection ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit (Lonza) on a 4D Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... with the Amaxa P3 Primary Cell 4D Nucleofector X Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2021Quote: ... supplemented with BEGM Bronchial Epithelial SingleQuots Kit (excluding GA-1000, Lonza), 10% fetal bovine serum ...
-
bioRxiv - Immunology 2021Quote: ... and SE Cell Line 4D Nucleofector X kit (Lonza, Basel, Switzerland). Each cuvette had 4 μg of DNA and 107 CHOZN cells concentrated in SE cell solution ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cell lines were monthly checked for Mycoplasma contaminations (LONZA – MYCOALERT KIT), and all samples analyzed in this study were not contaminated ...
-
bioRxiv - Molecular Biology 2020Quote: ... using an Amaxa Nucleofector 2b device and ES nucleofection kit (Lonza) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Transient siRNA transfections were performed using Amaxa kits C (Amaxa Lonza) for CEM.NKR-CCR5 cells ...
-
bioRxiv - Microbiology 2019Quote: ... and the P3 Primary cell 4D Nucleofector X Kit L (Lonza)(20) ...
-
bioRxiv - Microbiology 2021Quote: ... and Vero cells were tested for mycoplasma (Lonza MycoAlert detection kit) and human cell line identity was authenticated by ATCC ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells are monthly checked for mycoplasma contamination (MycoAlert detection kit, Lonza).
-
bioRxiv - Microbiology 2020Quote: ... Cells were tested monthly for mycoplasma MycoAlert Mycoplasma detection kit (Lonza) and treated with Mycoplasma Removal Agent (MP Biomedical ...