Labshake search
Citations for Active Motif :
1 - 20 of 20 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Mouse positive control primer set Actb2 (#71017, Active Motif) and mouse negative control primer set 1 (#71011 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Negative Primer Set 1 and 2 (Active Motif) as positive and negative controls for p-STAT4 binding (see table S1 for sequences) ...
-
bioRxiv - Genomics 2023Quote: ... Human Negative Control Primer Set 1 (Active Motif, #71001), Human Negative Control Primer Set 3 (Active Motif ...
-
bioRxiv - Genomics 2023Quote: ... Human Negative Control Primer Set 3 (Active Motif, #71023). For analysis ...
-
bioRxiv - Genomics 2023Quote: ... Human Positive Control Primer Set MYT1 (Active Motif, #71007), Human Negative Control Primer Set 1 (Active Motif ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mouse negative control primer set 1 (#71011, Active Motif) were used for validating the ChIP assays (Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... One negative control primer pair was used (Unt12, Human negative control primer set 1, Active Motif, catalog number 71001) as well as one positive control (DPF1 for RUNX2 ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using human positive and negative control qPCR primer sets from Active Motif (Supplementary Table S6). Furthermore ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using human positive and negative control qPCR primer sets from Active Motif (Additional file 1: Table S5). Immunoprecipitated material and input chromatin were submitted to the Genomics Core Facility (GCF ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using human positive and negative control qPCR primer sets from Active Motif (Additional file 1: Table S5). PCR primers were designed in the TSS region for selected genes (Additional file 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified DNA was analyzed by ChIP-qPCR data relative to input using the mouse negative control and mouse positive control primer set Gapdh in the ChIP-IT qPCR analysis kit (Active Motif). Reaction conditions were programmed with initial denaturation at 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute ...
-
bioRxiv - Immunology 2023Quote: ... Control primers were purchased from Active Motif: Hoxc10 (Cat# 71019 ...
-
bioRxiv - Microbiology 2020Quote: ... and primers targeting the Chr12 gene desert (Active Motif) or IFI44L promoter (forward primer = 5’ TTTCATGCCTGCCTACATAC 3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mouse Negative Control Primer Set1 (Commercially available from Active Motif) was used as negative control region ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2% of the mixture was set aside as input and 20ng of spike-in chromatin (Active Motif, #53083) was added to the rest ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tagmentation Master Mix was added to the pellet and reaction was incubated in a themomixer at 600-800 rpm set at 37C for 30 min as indicated by manufacturer (ATAC-Seq kit, 53150, Active Motif).
-
bioRxiv - Cell Biology 2022Quote: ... Primers against the GAPDH promoter were used as a positive control (Active Motif, cat. no. 71018).
-
bioRxiv - Genomics 2023Quote: ... incubated for 45 min at RT with primary antibody diluted in 1X PBS/1% BSA (H3K27me3, Active motif-61017 ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR duplicated alignments were removed from the BAM files using a perl script by Active Motif. Finally ...
-
bioRxiv - Bioengineering 2024Quote: Chromatin immunoprecipitation followed by real-time quantitative PCR (ChIP-qPCR) was performed using the ChIP-IT PBMC kit (53042; Active Motif, Carlsbad CA) according to manufacturer’s instructions ...