Labshake search
Citations for Vector Labs :
2351 - 2400 of 3153 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rhodamine conjugated Dolichos biflorus agglutinin (1:100, DBA, Vector Laboratories, RL-1032-2). Secondary antibodies used were goat anti-mouse AlexaFluor 647 and goat anti-rabbit AlexaFluor 488 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and using Glu-R1 (Millipore Cat# AB1504, 1:250; Vector Laboratories, Burlingame, CA, USA) for the primary and Anti-glutamate receptor 1 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... and biotinylated goat anti-rabbit IgG antibody (1:200, Vector Labs, BA-1000-1.5), and revealed by ABC kit (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used ABC (avidin biotinylated horseradish peroxidase complex, 1:300, Vector Laboratories, #PK-4000) and DAB as a chromogen.
-
bioRxiv - Neuroscience 2023Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... Lotus Tetragonolobus Lectin (LTL)-fluorescein (1:400, FL-1321-2, Vector Laboratories, Newark, CA), goat anti-rabbit IgG Alexa Fluor 647 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Additional staining reagents included biotinylated Dolichos biflorus agglutinin (1:400; Vector Laboratories; #B-1035) and streptavidin Alexa 350 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were incubated in 1:200 FITC-PNA (Vector Laboratories, Cat# FL-1071-10) and 1:5000 DAPI (10 mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... 150 µl of a 1/200 dilution biotinylated anti-mouse antibody (Vector Laboratories, USA) was added for 30 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... Philippe Ciofi) followed by biotinylated goat anti-guinea pig IgG (1:1,000, Vector Laboratories) and DyLight Streptavidin 488 (1:500 ...
-
bioRxiv - Physiology 2024Quote: ... biotinylated wisteria floribunda lectin (WFA, 1/2000, Vector laboratories #B-1355, Les Ulis, France) with Alexa Fluor 488 Avidin (1/1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... signal amplification after species-specific secondary biotinylated antibody incubation of two hours was done using an avidin/biotin-based peroxidase system (PK6100, ABC Vectastain Elite kit, Vector Laboratories, UK). Chromogen development was sequential with double labelling ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibody double labelling was through an ImmPress Duet double staining anti-mouse HRP (brown)/anti-rabbit AP (magenta) kit (MP7724, Vector Laboratories, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... the sections were subjected to the staining protocol of the Vectastain Universal Elite ABC Kit (PK-6200, Vector Laboratories, Inc., Burlingame, CA). Finally ...
-
bioRxiv - Cancer Biology 2020Quote: ... unspecific bindings (5% BSA, 5% NGS in PBST, 1h) and Avidin/Biotin (Avidin/Biotin Blocking Kit, Vector Laboratories, SP-2001, 15 min). Samples were incubated overnight at 4°C with anti-MDA antibody (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then incubated with secondary anti-mouse antibody (Immpress-HRP anti-mouse IgG (peroxidase polymer detection kit, Vector Laboratories, Burlingame, CA) for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and BrdU (mice, AbD Serotec) were detected with biotinylated secondary antibodies (Jackson) and the Vector-Elite ABC kit (Vector Laboratories, Burlingame, CA). Finally ...
-
bioRxiv - Neuroscience 2020Quote: ... Another PBS/TWEEN washing battery was performed and sections were then incubated in an avidin-biotin-peroxidase complex (ABC kit, Vector Laboratories®) for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by incubation with a monoclonal secondary horseradish peroxidase (HRP)-coupled horse-anti-rabbit antibody (ImmPRESS Reagent Kit, MP-7401, Vector Laboratories, Germany) with AEC+ (K346 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed again three times in PBS and the 3,3’-diaminobenzidine (DAB) chromogen DAB Peroxidase (HRP) Substrate Kit (Vector Laboratories, Burlingame, CA) prepared immediately prior to use and addition to each slide individually ...
-
bioRxiv - Physiology 2021Quote: ... the sections were immunostained by the avidin–biotin peroxidase method using the Vectastain Elite Kit (PK-6102, Vector Laboratories, Burlingame, CA, USA) with 3–3-diaminobenzidine and hydrogen peroxide as the chromogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were subsequently incubated with the respective primary and secondary antibodies (Table S3) using an ImmPRESS™ HRP Anti-Mouse IgG (Peroxidase) Polymer Detection Kit (Vector Laboratories) for 60 min at RT ...
-
bioRxiv - Physiology 2020Quote: ... Signal amplification was performed using an ABC Kit (Vectastain, #PK6100) for 30 min at RT followed by DAB (Vector Labs, #SK-4100) sub-strate ...
-
bioRxiv - Neuroscience 2020Quote: ... Antigen retrieval was performed by boiling for 20 min in a 0.01 M sodium citrate (pH 6.0) solution and endogenous biotin was blocked using the Avidin/Biotin Blocking Kit (Vector Labs, SP-2001). Slides were incubated overnight with primary antibodies against anti-rabbit H3K4me3 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2021Quote: ... Following, the secondary antibody (The ImmPRESS Universal Antibody Kit, anti-mouse/rabbit) and ImmPACT DAB (both purchased from Vector Laboratories, Burlingame, CA) was applied according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Chromogen development was then conducted with HRP 3,3’-Diaminobenzidine (DAB) or Vector Blue kits (Vector Laboratories, Cat # SK-4100 or SK-5300). Chromogen development was halted by submersion in tap water ...
-
bioRxiv - Cell Biology 2021Quote: ... before peroxidase staining was conducted for 30 min with a peroxidase staining kit (VECTASTAIN® ABC Reagent, cat # PK-4000, Vector Laboratories) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then incubated with polymer-HRP-conjugated horse anti-goat IgG antibody (ImmPRESS™ HRP Anti-Goat IgG Polymer Detection Kit, Vector Laboratories) for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... non-specific binding was blocked for 30 minutes using 2.5% normal horse serum from the ImmPRESS Anti-Mouse IgG / Anti-rabbit IgG Reagent Kit (Vector Laboratories, CA, USA). (iii ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and blocked with 10% goat or rabbit serum in PBS for 60 min and with Avidin/Biotin Blocking Kit (Vector Laboratories, Inc.) for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... The Aβ 42/40 double-labelled samples were incubated in ImmPRESS horseradish peroxidase polymer then ImmPRESS alkaline phosphate polymer kits for 30 mins each (Vector Laboratories, US). For these sections ...
-
bioRxiv - Systems Biology 2024Quote: ... Sections were rinsed once more in 0.1% Triton-X in TBS then incubated in an avidin-biotin complex (PK-6100; Vectastain ABC Elite kit, Vector Laboratories, Newark, CA) for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: Slices containing biocytin fills were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer overnight and processed with Vectastain ABC (avidin-biotinylated HRP complex) Elite Kit (Vector Labs, Burlingame, CA). The shape of the slice ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody binding and 3,3’-diaminobenzidine staining was performed according to the manufacturer’s instruction (Vectastain Elite ABC Kit, Vector Labs, Peterborough, United Kingdom). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by blocking of nonspecific binding sites using normal goat serum (10%) and an avidin/biotin blocking kit (Vector Laboratories, Burlingame, CA). Sections were incubated with phospho-SMAD2/3 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2023Quote: ... and anti-mouse βIII Tubulin (Table S2) was revealed using a mouse-on-mouse kit according to manufacturer’s instructions (Vector laboratories, Burlingame, CA).
-
bioRxiv - Cell Biology 2022Quote: ... Engineered cartilage sheet sections were also treated with pronase and primary anti-Collagen Type II (DSHB II-II6B3) followed by VectaFluor R.T.U Antibody Kit DyLight® 488 (Vector Labs DI-2788) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and then processed for secondary and HRP reagent using a Vectastain ABC kit according to the manufacturer’s instructions (Rat IgG, Vector Laboratories, PK-4004). Antibody binding was visualized with DAB-nickel (VWR ...
-
bioRxiv - Physiology 2023Quote: ... Another block was applied with streptavidin and then biotin solutions (Streptavidin/Biotin Blocking Kit, Vector Labs; Newark, CA, USA; Cat. No.: SP2002) at room temperature for 15 min each ...