Labshake search
Citations for Vector Labs :
2301 - 2350 of 3153 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-goat or goat anti-rabbit (1:200, Vector laboratories Inc., Burlingame, USA). Antibodies were combined with standard ABC reagents (Vectastain Elite ABC kit ...
-
bioRxiv - Neuroscience 2020Quote: ... and visualized using biotinylated goat anti-rabbit IgG (1:200, Vector Laboratories, CA, USA). Signals were developed with the Vectastain ABC kit (PK-4001 ...
-
bioRxiv - Neuroscience 2020Quote: ... for 24hrs and a biotinylated goat-anti-rabbit secondary antibody (1:1500; Vector Laboratories) for 90min ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-rabbit biotinylated secondary sera at 1:500 (Vector Laboratories, BA-1000). For the detection of the antibody with DAB ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h and mounted using Vectorshield mounting media with DAPI (H1200, Vector Laboratories). Images were captured using a Zeiss Axio Imager microscope (Carl Zeiss GmbH ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplification was achieved with avidin-biotin complex (1:400, ABC; Vector Laboratories, Peterborough, UK) for 2h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplification was achieved with avidin-biotin complex (1:500, ABC; Vector Laboratories, Peterborough, UK) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 15 to 20 µL of 10 mg·mL−1 biotinylated BSA (Vector Laboratories, Burlingame CA) was introduced and allowed to bind to the glass surface for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... and Ulex Europaeus Agglutinin (UEA)1-Rhodamine (2μg/ml, Vector Laboratories #RL-1062-2) for 20min at 4◦C ...
-
bioRxiv - Cell Biology 2020Quote: ... tissue sections were incubated with biotinylated anti-mouse IgG (1:200 dilution, Vector Laboratories) for 1 h at room temperature then washed thrice ...
-
bioRxiv - Neuroscience 2022Quote: ... for 1 h and mounted using Vectorshield mounting media with DAPI (H1200, Vector Laboratories). Images were captured using a Zeiss Axio Imager microscope (Carl Zeiss GmbH ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 90 min amplification in avidin-biotin complex (ABC; Vector Lab, 1:500). Sections were then reacted in 3,3’-Diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2022Quote: ... The secondary HRP conjugated antibodies included anti-rabbit (1:2000, PI-1000, Vector laboratories) and anti-mouse (1:2000 ...
-
bioRxiv - Bioengineering 2022Quote: ... Secondary antibody anti-Rabbit IgG conjugated to HRP (Goat mAb, Vector Laboratories, 1:8,000) was used for detection of proteins using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2003) in 1% BSA in TBS followed by anti-rabbit horseradish peroxidase (Vector Laboratories) in TBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies biotin conjugated goat anti-rabbit (BA-1000, Vector Laboratories, dilution 1:200) and goat anti-mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... Labeling was amplified by avidin–biotin complex (1:1000; Vector Laboratories, Burlingame, CA, USA) by incubation for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-Mouse IgG (1: 2,000, Cat No: DI-2488, Vector Laboratories, Burlingame, CA). Each Western blot was performed using three independent biological replicates.
-
bioRxiv - Biochemistry 2019Quote: ... and incubated with biotinylated goat-anti-rabbit antibody (Vector Laboratories, BA-1000, 1:200) for one hour ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-rat or anti-mouse IgG (1:1,000, Vector Laboratories Inc., Burlingame, CA, USA) for 2 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... biocytin was labeled with DyLight 594 conjugated streptavidin (1:200, Vector Labs, SA-5594) to reveal if the recorded cell was coupled or not.
-
bioRxiv - Neuroscience 2019Quote: ... membranes were incubated with secondary horse anti-mouse HRP-conjugated (1:20,000; Vector laboratories) or anti-rabbit HRP-conjugated (1:20,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were washed for 1 hr with PBSTx and mounted in VectaShield (Vector Laboratories).
-
bioRxiv - Developmental Biology 2021Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
bioRxiv - Pathology 2020Quote: ... and incubated with biotinylated goat anti-mouse IgG (1:1000; Vector Laboratories, CA, USA) or biotinylated goat anti-rabbit IgG (1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... Capillaries were visualized by staining with lectin (Biotinylated Griffonia simplifolia Lectin 1; Vector lab), followed by a Streptavidin Qdot 655 (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 4’6’-diamidino-2-phenylindole (DAPI) diluted 1:5 in Vectashield mounting media (Vector Labs) was used as a counterstain ...
-
Long-term alterations in brain and behavior after postnatal Zika virus infections in infant macaquesbioRxiv - Neuroscience 2019Quote: ... Sections were then incubated in horse anti-goat secondary antibody (1:200; Vector Labs) for 1 hour ...
-
bioRxiv - Genetics 2020Quote: ... Biotinylated secondary antibodies: goat anti-rabbit and horse anti-goat (1:200, Vector Labs).
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with biotin-conjugated secondary antibodies (Vector Lab, BA-9200; 1:200) and horseradish peroxidase (HRP)-conjugated streptavidin (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in avidin–biotinylated horseradish peroxidase complex (Elite ABC; 1:300; Vector Laboratories) diluted in TBS for 3 h at room temperature or overnight at 4 °C ...
-
bioRxiv - Zoology 2021Quote: ... and biotinylated goat anti-rabbit IgG (BA1000, VECTOR Laboratories, Burlingame, CA, USA; 1:500) for 1 day at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Two 15-cm petri dish were incubated with BSL-1 (5μg/mL, Vector Labs) in D-PBS for at least 2 hours at room temperature (negative panning dishes) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
Hormonal contraceptives alter amphetamine place preference and responsivity in the intact female ratbioRxiv - Animal Behavior and Cognition 2021Quote: ... primary incubation used rabbit antiserum against FOS (1:2500; Vector Laboratories, Inc., Burlingame, CA) and secondary incubation used biotinylated goat anti-rabbit IgG (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... or biotinylated goat anti-rabbit/mouse IgG antibody (1:1000, BA-1000, Vector Laboratories) in PBS-BX for 2 hours at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... The secondary antibody (goat anti-rabbit bioninylated, 1:200, Vector laboratories Cat # BA-1000) was incubated for 1 hour at room temperature followed by a 30-minute incubation with Avidin-Biotin complex (ABC kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were detected by biotinylated anti-rabbit (BA-1000; 1:500; Vector Laboratories). Fluorescein-conjugated avidin D (A-2001 ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with biotin-labeled secondary antibody (Vector Laboratories, Newark, CA, BA-2000, 1:200) was performed at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... Horse anti-rabbit biotinylated IgG (1:400; VC-BA-1100-MM15; Vector Laboratories; IF), streptavidin Alexa Fluor 555 conjugate (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were treated with biotinylated donkey-anti-mouse IgG (1:300; Vector Laboratories) for 2 h ...
-
bioRxiv - Physiology 2022Quote: ... 1:1000 and secondary ImmPRESS HRP Goat Anti-Rat IgG (Vector Laboratories, Burlingame, California) to assess the macrophage content of type III lesions.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... The secondary antibody used was peroxidase-labelled anti-rabbit IgG (1:5000, Vector Laboratories). SuperSignal West Femto ECL (Pierce ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... Lotus Tetragonolobus Lectin (LTL)-fluorescein (1:400, FL-1321-2, Vector Laboratories, Newark, CA), goat anti-rabbit IgG Alexa Fluor 647 (1:500 ...