Labshake search
Citations for PerkinElmer :
1 - 50 of 673 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Binding of nucleobases was performed by means of the scintillation proximity assay (SPA) using His-tagged PurTCp in conjunction with Copper HIS-Tag YSI beads (Perkin Elmer, RPNQ0096). 250 ng of purified PurTCp were immobilized on 125 μg SPA beads per 100-μL assay in 200 mM Tris/Mes at the indicated pH ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 nM Europium labeled anti-His antibody (Perkin Elmer), 0.5x Streptavidin-xl665 (Cis Bio ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: [125 I]-Bolton-Hunter labeled Transforming Growth Factor- β1 (Human, Recombinant) (catalog NEX267) was obtained from Perkin Elmer (Waltham, MA) This product was however discontinued in 2019 ...
-
bioRxiv - Pathology 2024Quote: ... Recombinant human BMP4-induced pSMAD1 signalling was measured by AlphaLISA SureFire Ultra p-SMAD1 (Ser463/465) assay kit (Perkin Elmer). To perform the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then for the 6xHIS-tagged HAT module a 10 µL mixture of 5 µg/mL AlphaLISA Nickel chelate acceptors beads (PerkinElmer #AL108) and 10 µg/mL AlphaScreen donor beads (PerkinElmer #6760002) ...
-
bioRxiv - Immunology 2022Quote: ... and Eu3+-tagged streptavidin (1244-360, PerkinElmer) diluted 1:1,000 in TBS/Tw containing 25 μM EDTA were subsequently added to the wells and incubated at RT for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... and Eu3+-tagged streptavidin (1244-360, PerkinElmer) diluted 1:1,000 in TBS/Tw containing 25 μM EDTA were subsequently added to the wells and incubated at RT for 1 hour ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified hDGAT1 (with his tag) was absorbed onto Copper HIS-Tag PVT beads (Perkin Elmer, RPNQ0095) and incubated with [3H]-Acetyl-CoA (ARC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Europium labelled anti-His (Perkin Elmer # AD0110) and XL665 labelled streptavidin (CIS Bio 610SAXAC ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Microbiology 2024Quote: ... [32P] phosphate (1 Ci/mmol; Perkin Elmer), or [33P] phosphate (1 Ci/mmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Pathology 2020Quote: ... rats were administered 3mL of an isotonic sodium phosphate/sodium chloride solution containing 300μmol of phosphate and ~9.7 million Bq of 33PO4 (NEN Radiochemicals, Perkin Elmer) was infused intravenously into the jugular vein over 10 minutes (KD Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-His Donor and Streptavidin Acceptor AlphaLISA beads (PerkinElmer) were added at final concentration 10 mg/mL to each well and incubated on RT for 3 h ...
-
bioRxiv - Neuroscience 2020Quote: ... using Copper HIS-Tag YSi SPA beads (Perkin Elmer) and radioactively labeled Organon ([3H]Org24598 ...
-
bioRxiv - Pathology 2022Quote: ... and calcium phosphate with OsteoSense 680EX (PerkinElmer NEV10020EX) or AR solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 25 nM biotinylated and hexahistidine-tagged linker peptide (Bn-His6) (PerkinElmer) was added to the compounds ...
-
bioRxiv - Biochemistry 2023Quote: Endogenously tagged HiBiT cells were plated in 96-well plates (PerkinElmer) at a density of 0.5×106 cells/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... YSi (Yttrium silicate) copper-coated His-tag beads (Perkin Elmer) were used in combination with α[32P]GTP (American Radiolabeled Chemicals ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the DNA 1K / 12K / Hi Sensitivity Assay LabChip (Perkin Elmer) and the LabChip DNA High Sensitivity Reagent Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA probes were tagged with dinitrophenol-11-UTP (DNP, Perkin Elmer, Waltham, Massachusetts), fluorescein-12-UTP (FITC ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µL of anti-6X His acceptor beads (Perkin Elmer, reference AL178) were then added and after 1h of incubation at RT with rotation ...
-
bioRxiv - Cancer Biology 2020Quote: H2B-mRFP tagged cells were imaged using an OperaTM High Content Screening instrument (PerkinElmer), equipped with a 20x air objective (LUCPLFLN ...
-
bioRxiv - Genomics 2022Quote: ... For GST-tagged proteins a 10 μl mix of 2.5 μg/ml glutathione (PerkinElmer) and 5 μg/ml streptavidin donor beads (PerkinElmer ...
-
bioRxiv - Immunology 2020Quote: We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2020Quote: ... Streptavidin-coated Alpha donor beads or anti-His-conjugated AlphaLISA acceptor beads (PerkinElmer) were used at a final concentration of 10 μg/mL per well ...
-
bioRxiv - Systems Biology 2023Quote: ... The NPCs were cultured in a 12-well dish to confluency in NPC media and then dissociated using Accutase for 5 minutes at 37°C to single cell resolution and plated on 5 µg/mL human laminin and 5µg/mL fibronectin-coated 384 well plates (Perkin Elmer Cat #6057308) at 12,000 cells/well in NPC media and 10 µM ROCKi ...
-
bioRxiv - Molecular Biology 2023Quote: ... its complementary oligo nucleotide DNA was labeled with radioactive phosphate (Perkin Elmer). For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Biochemistry 2023Quote: ... 25 µg/mL acceptor (nickel chelate) and donor (anti-his europium; both Perkin Elmer). All components were diluted to working concentrations in alphaLISA buffer (50 mM HEPES ...