Labshake search
Citations for PerkinElmer :
1 - 50 of 765 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Radioactive nucleotides were from PerkinElmer Life Sciences (Waltham ...
-
bioRxiv - Genomics 2022Quote: ... and Cy3-dCTP-nucleotides (PerkinElmer) at 42°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cyclic olefin 384-well microplate (CellCarrier Ultra, PerkinElmer, cat # 6057300), 125 µL buffer containing 1X PBS (pH 7.4 ...
-
bioRxiv - Biochemistry 2019Quote: Radioactive nucleotides were from Perkin Elmer and unlabeled nucleotides were from GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: Radioactive nucleotides were from Perkin Elmer and unlabeled nucleotides were from GE Health-care ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Biochemistry 2019Quote: ... HRP-dependent luminescence was developed with Western Lightning Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences ...
-
bioRxiv - Pathology 2022Quote: ... and calcium phosphate with OsteoSense 680EX (PerkinElmer NEV10020EX) or AR solution ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... its complementary oligo nucleotide DNA was labeled with radioactive phosphate (Perkin Elmer). For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Bioengineering 2023Quote: ... near-infrared bisphosphonate-based calcium dye (OsteoSense 680, Perkin Elmer) for 20 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Probes were radiolabelled with 32P-ATP by poly nucleotide kinase (PNK) (PerkinElmer PNK) for 1 hour at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Radio-labeled nucleotides (α32P-ATP, γ32P-GTP, 35S-GTPγS) were purchased from Perkin Elmer.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 nM Europium labeled anti-His antibody (Perkin Elmer), 0.5x Streptavidin-xl665 (Cis Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... [35S]-GTPγS (1250 Ci/mmol) and [5,8-3H]-adenosine 3,5-cyclic phosphate (34.0 Ci/mmol) were from Perkin Elmer (Boston, MA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Genomics 2024Quote: ... The detection of cAMP-dependent expression was performed using an Envision plate reader (PerkinElmer, Waltham, MA, USA), based on luciferase-based luminescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2022Quote: Nucleotide exchange assays were carried out at 20 °C using a LS55 luminescence spectrometer (Perkin Elmer) with 5 nm slit widths (Ex/Em 295 nm/345 nm) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Neuroscience 2021Quote: NPCs were seeded onto poly-L-ornithine/laminin-coated 6-well and cyclic olefin co-polymer-based 96-well Cell Carrier Ultra microtiter plates (Perkin Elmer, Waltham, MA) at 1×105 and 2×103 cells/well ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell plate was placed into the CellLux Calcium Imaging System (PerkinElmer, Waltham, USA) and the assay was performed automatically according to the following protocol ...
-
bioRxiv - Plant Biology 2024Quote: ROS production was monitored by the use of a luminol-dependent assay as previously described (Butenko et al., 2014) using a Wallac 1420 VICTOR2 microplate luminometer (PerkinElmer). Arabidopsis leaves expressing 35S:HAE:YFP were cut into leaf discs and incubated in water overnight before measurements ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Neuroscience 2019Quote: ... Calcium imaging was performed on a spinning disk confocal microscope (20X, NA 0.75, UltraVIEW VoX, PerkinElmer) at 37°C and 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Calcium measurements were carried out in a PerkinElmer fluorescence spectrophotometer (LC50, Perkin Elmer, Waltham, MA, USA), with excitation wavelengths of 340 nm and 380 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... Calcium measurements were carried out in a PerkinElmer fluorescence spectrophotometer (LC50, Perkin Elmer, Waltham, MA, USA), with excitation wavelengths of 340 nm and 380 nm ...
-
bioRxiv - Microbiology 2019Quote: ... was achieved by addition of GDP- or UDP-GloTM nucleotide detection reagent following manufacturers’ instructions and analyzed via luminescence using a Victor 2 microplate reader (PerkinElmer).
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 50 ng was used for random priming reactions in the presence of the radiolabeled nucleotide [α-32P]-dCTP (3,000 Ci/mmol, 10 mCi/ml, Perkin Elmer) using a random primer DNA labeling kit (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... The saturation binding assay was conducted using an 8-point dose-dependent concentration of [3H] ketanserin (maximal concentration 20 nM) (Perkin Elmer, Waltham, MA) with brain crude membranes (25 μg membrane proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Total iron and calcium were measured on an AAnalyst 100 Atomic Absorption Spectrophotometer (Perkin Elmer, Waltham, MA 02451). Samples were compared to in-house standards and external standards produced by Ricca Chemical Company (Arlington ...
-
bioRxiv - Neuroscience 2020Quote: ... For CC3 staining secondary antibody was followed by signal amplification using TSA Plus Cyanine 3 System (PerkinElmer). Following the incubation with the secondary antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... BRB80 was mixed with a 1/10 volume of 10X nucleotide exchange buffer (10 mM GTP, 30 nM GTP α-32P (PerkinElmer BLU506H250UC), 1 mM nocodazole ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.