Labshake search
Citations for PerkinElmer :
1 - 50 of 1314 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cell Biology 2019Quote: ... Between 3 and 8 fields per well were acquired and analyzed using Acapella 2.6 (PerkinElmer). For all nuclear markers ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal detection was performed by 8 min incubation with the PerkinElmer TSA Plus Cyanine 3 kit (PerkinElmer, NEL744E001KT ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Microbiology 2019Quote: ... which were incubated with various concentration of synthetic biotinylated TAR-RNA (biotin 5’-dT/GGU CUC UCU GGU UAG ACC AGA UCU GAG CCU GGG AGC UCU CUG GCU AAC UAG GGA ACC/3’-biotin dT) (Integrated DNA Technologies) at 4°C for 3 h in the AlphaLISA buffer (PerkinElmer). Anti-His Donor and Streptavidin Acceptor AlphaLISA beads (PerkinElmer ...
-
bioRxiv - Microbiology 2020Quote: ... 100 µM of 5’-phosphorylated 4-nt primer ACCA (Perkin Elmer) and 5% DMSO containing ERDRP-0519 at the specified concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Microbiology 2021Quote: ... The filters were immersed into 4 ml liquid scintillation cocktail (Optiphase HiSafe 3, Perkin Elmer) and the radioactivity of each filter was measured by a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Cell Biology 2023Quote: All the videos (2 min, 4-5 frames s-1) were acquired at 37°C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2021Quote: ... Radioactivity was measured by adding the samples into 4 ml liquid scintillation cocktail (OptiphaseHiSafe 3, PerkinElmer) and counting with a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 nM [1-14C]oleate (Perkin Elmer), 50 ng/ml BODIPY 665/676 (Life Technologies) ...
-
bioRxiv - Pathology 2021Quote: ... primary hepatocytes were serum-starved for 3 hours and incubated for 3-hour with [1-14C] acetate (1 μCi/ml; Perkin Elmer, Boston, MA) and 5.5 mM of non-labeled (cold ...
-
bioRxiv - Genomics 2020Quote: ... washing (3 times 5 min in TNT) and 8 min incubation using Fluorescein Tyramide (for pimonidazole NEL701A001KT, perkin Elmer) or Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent.
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 3 (1:1000, Perkin Elmer NEL744E001KT), and TSA® Plus Cyanine 5 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA Plus Cyanine 3 System (Perkin Elmer, 1:50). Nuclear staining was obtained using DAPI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... or TSA Plus Cyanine 3 (Cy3; 1:100; PerkinElmer; #NEL744001KT). Sections were imaged on an Olympus AX70 microscope with a Zeiss AxioCam HRcRv.2 camera ...
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 5 (PerkinElmer, 1:1,000) was used as a secondary fluorophore for C1 probes (Gtpbp2 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by molecular sieve (9’ Molecular Sieve 13x 1/8’’ Sf; PerkinElmer Inc., Waltham, USA) kept at 60 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... For all assays 1 μCi [3 H]-D-glucose (PerkinElmer, USA) was used as the radioactive tracer ...
-
bioRxiv - Genetics 2022Quote: ... treated with the TSA Plus Cyanine 3 System 1% (PerkinElmer, USA) for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1: 5000 followed by incubation with 1:50 to 1: 100 TSA plus Cyanine 3 solution (Perkin Elmer). To detect two genes at a time ...
-
bioRxiv - Immunology 2021Quote: ... with the last 8 hours in the presence of [3H] thymidine (1 mCi/well, NET027001MC; PerkinElmer). Incorporated [3H] thymidine was counted by a BetaPlate scintillation counter (Wallac ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1:1000 Cyanine 5 amplification reagent (PerkinElmer, #FP117024UG) in TSA buffer (ACD ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3H-mannitol (4 µCi ml−1, NET101, Perkin Elmer), the latter serves as an extracellular marker 33 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µM S-adenosyl Methionine (1 µM 3H-SAM (Perkin Elmer); 3 µM cold SAM ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...