Labshake search
Citations for PerkinElmer :
1 - 50 of 910 citations for 6 Quinoxalinamine 2 3 5 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Cancer Biology 2024Quote: ... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Image acquisition was performed using Volocity versions 5 and 6 (PerkinElmer). Routine imaging performed using Plan Apochromat 60 or 100× oil immersion objectives ...
-
bioRxiv - Genetics 2020Quote: ... or 6 μM of Texas Red-5-dATP (Perkin Elmer, NEL471001EA) in 800 μl of 1 × NEBuffer 2 and carried out at 37°C for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Supplemental Figure 5 and Supplemental Figure 6 were exported from Volocity (Perkin Elmer) as single files with merged Z-planes and separate channels ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM ATP and 5 μCi [γ-32P] ATP (PerkinElmer) were used to start the reaction for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Microbiology 2019Quote: ... Collected cell batches on polycarbonate filters were directly transferred into 6 ml scintillation vials and mixed with 5 ml UltimaGold XR (Perkin Elmer) scintillation cocktail ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2021Quote: ... 500nl of 2 µM siRNAs (20nM final concentration) were distributed on 6 different 384-well imaging plates (CellCarrier Ultra, Perkin Elmer), as described in Table 3 ...
-
bioRxiv - Immunology 2021Quote: ... brain and testis tissue samples from hACE2 transgenic mice challenged intranasally with SARS-CoV-2-nLuc (1 x 105 FFU; 6 dpi) were imaged after necropsy using bioluminescence imaging (IVIS, Perkin Elmer), pruned to isolate regions with high nLuc activity and immediately pre-fixed with 3 % glutaraldehyde ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Plant Biology 2023Quote: ... resuspended in 2 N NaOH and mixed with 5 volumes scintillation fluid (Ultima Gold™ XR, PerkinElmer) for 14C-CPM counting in a TRI-CARB liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).