Labshake search
Citations for PerkinElmer :
1 - 50 of 1025 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Cancer Biology 2021Quote: ... Image acquisition was performed using Volocity versions 5 and 6 (PerkinElmer). Routine imaging performed using Plan Apochromat 60 or 100× oil immersion objectives ...
-
bioRxiv - Genetics 2020Quote: ... or 6 μM of Texas Red-5-dATP (Perkin Elmer, NEL471001EA) in 800 μl of 1 × NEBuffer 2 and carried out at 37°C for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Supplemental Figure 5 and Supplemental Figure 6 were exported from Volocity (Perkin Elmer) as single files with merged Z-planes and separate channels ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: All the videos (2 min, 4-5 frames s-1) were acquired at 37°C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
bioRxiv - Microbiology 2019Quote: ... which were incubated with various concentration of synthetic biotinylated TAR-RNA (biotin 5’-dT/GGU CUC UCU GGU UAG ACC AGA UCU GAG CCU GGG AGC UCU CUG GCU AAC UAG GGA ACC/3’-biotin dT) (Integrated DNA Technologies) at 4°C for 3 h in the AlphaLISA buffer (PerkinElmer). Anti-His Donor and Streptavidin Acceptor AlphaLISA beads (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
bioRxiv - Microbiology 2020Quote: ... 100 µM of 5’-phosphorylated 4-nt primer ACCA (Perkin Elmer) and 5% DMSO containing ERDRP-0519 at the specified concentration ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM ATP and 5 μCi [γ-32P] ATP (PerkinElmer) were used to start the reaction for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Microbiology 2021Quote: ... The filters were immersed into 4 ml liquid scintillation cocktail (Optiphase HiSafe 3, Perkin Elmer) and the radioactivity of each filter was measured by a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2021Quote: ... Radioactivity was measured by adding the samples into 4 ml liquid scintillation cocktail (OptiphaseHiSafe 3, PerkinElmer) and counting with a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Immunology 2019Quote: ... After 4-6 washes with 1x TBST the membrane was treated with chemiluminescent substrate Western Lightning ECL Pro (Perkin Elmer; NEL120001EA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Microbiology 2019Quote: ... Collected cell batches on polycarbonate filters were directly transferred into 6 ml scintillation vials and mixed with 5 ml UltimaGold XR (Perkin Elmer) scintillation cocktail ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Cell Biology 2021Quote: ... 500nl of 2 µM siRNAs (20nM final concentration) were distributed on 6 different 384-well imaging plates (CellCarrier Ultra, Perkin Elmer), as described in Table 3 ...
-
bioRxiv - Immunology 2021Quote: ... brain and testis tissue samples from hACE2 transgenic mice challenged intranasally with SARS-CoV-2-nLuc (1 x 105 FFU; 6 dpi) were imaged after necropsy using bioluminescence imaging (IVIS, Perkin Elmer), pruned to isolate regions with high nLuc activity and immediately pre-fixed with 3 % glutaraldehyde ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...