Labshake search
Citations for Qiagen :
1 - 50 of 5861 citations for hsa mir 222 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306, gene globe ID YP00204783). Relative fold changes of miR223-3p of fro/fro mice were calculated to +/fro mice by using the formula ...
-
bioRxiv - Molecular Biology 2021Quote: ... commercially obtained hsa-let-7a-5p or hsa-miR-205-5p miRCURY LNA miRNA Inhibitor (Qiagen, cat# YI04101776 and YI04101508 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Ct values for hsa-miR-145-5p (Qiagen, YP00204483) were normalized to expression levels of hsa-miR-423-5p (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR-324 inhibitors (hsa-miR-324-5p and hsa-miR-324-3p miRCURY LNA miRNA Inhibitor) were obtained from QIAGEN. The sequences of synthetic siRNAs and miRNAs are listed in Supplementary Table S1.
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Cancer Biology 2020Quote: ... were normalized to expression levels of hsa-miR-423-5p (Qiagen, YP00205624) to determine fold change.
-
bioRxiv - Cancer Biology 2020Quote: ... anti-hsa-miR-181a-5p miScript miRNA Inhibitor (20 nmol, Qiagen, cat# MIN0000256).
-
bioRxiv - Neuroscience 2023Quote: ... Samples were normalized for the relative expression of the housekeeping miR103a-3p (hsa-miR-103a-3p, LNA™ PCR primer set, Qiagen), which showed no variability between analyzed groups.
-
bioRxiv - Cancer Biology 2023Quote: ... hsa-miR-29c-3p and hsa-miR-30b-3p were purchased (Qiagen). Karpas1718 cells (1 million per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... mmu-miR-130b-5p (Qiagen, MSY0004583), has-miR-130b-3p (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Specimens were incubated for 24 hours at room temperature in the presence of either an ASO antimiR targeting hsa-miR-134-5p (‘Ant-134’; Qiagen, Manchester ...
-
bioRxiv - Molecular Biology 2023Quote: ... and has-miR-130b-5p (Qiagen, MIMAT0004680) were transiently expressed to induce senescence-like phenotype ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Ant-has-miR-130b-5p (Qiagen, MIMAT0004680) were employed to inhibit the respective microRNAs ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: For SYBR Green and Taqman PCR Serial dilutions of known standards were made using synthetic miR-122 (syn has-miR-122-5p, 219600, Qiagen). The dilutions were prepared in triplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were co-transfected at DIV 19 with 10nM of a miR-499-5p or control pLNA inhibitor (miRCURY LNA miRNA-499-5p Power Inhibitor: miR-499-5p or Neg Control A, QIAGEN). After 72h of expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA template was amplified using microRNA-specific miRCURY LNATM primers for mature miR-9-5p (YP00204513, Qiagen). qRT-PCR was performed as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA™ PCR primer set (Qiagen). PCR amplification and detection were performed with the Applied Biosystems StepOnePlus Real-Time detector ...
-
bioRxiv - Molecular Biology 2019Quote: ... gambiae miR-276-5p miScript miRNA Mimic (100 ng, Qiagen) at a final concentration of 100 nm were co-transfected into Drosophila S2 cells using FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... The mmu-miR-122-5p miRCURY LNA probe (YD00615338, QIAGEN) was used to detect the dre-miR-122-5p mature form ...
-
bioRxiv - Molecular Biology 2019Quote: Quantification of miR-9-5p expression in kidney mice samples was performed using the miRCURY LNA RT Kit (Qiagen). Following RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... and transfected 24 hours later with 100 nM antisense oligonucleotide targeting miR-194-5p or miR-608 as control (miR-608 is not expressed in Hep G2 cells) (Exiqon, Qiagen) using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed to amplify microRNA 223-3p using the primer hsa-miR-223-3p miRCURY LNA miRNA PCR Assay (Qiagen, #339306, gene Globe ID: YP00205986) and LNA SYBR green PCR kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression levels of miR-142-5p were analyzed using miScript PCR System or miRCURY LNA SYBR Green PCR Kit (Qiagen). Specific primer pairs (miScript Primer Assay or miRCURY LNA miRNA PCR Assay ...
-
bioRxiv - Pathology 2020Quote: ... and the RT product was used for detection of miR-574-5p/3p and control RNA Snord68 using the miScript Primer Assay (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: miScript or miRCURY LNA Primer Assay was used to quantify the expression of miR-146a-5p (MS00003535 or YP00204688; Qiagen) in MIN6 cells or mouse pancreatic islets ...
-
bioRxiv - Neuroscience 2022Quote: ... miR-495 pLNA (miRCURY LNA miRNA Power Inhibitor HSA-MIR-495-3P, Qiagen #339130 YI04101229-DCA).
-
bioRxiv - Neuroscience 2024Quote: ... mice received a 0.5μM dose of a miR-505-5p mimic (Qiagen) or negative control combined with HiPerfect transfection reagent (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... The Hsa-miR-124-3p miRCURY LNA miRNA mimic (Qiagen, Germantown, MD) was used at 15µM with miR-124 inhibitor ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... validated assay to target hsa-MIR-941 (Qiagen product# 339306, catalogue# YP00204574). Each 10µl reaction was made up of the following ...
-
bioRxiv - Cell Biology 2020Quote: ... hsa-miR-494-3p miRCURY LNA™ microRNA Mimic (YM00472106, MIMAT002816, Qiagen), miR-control (CAT#4464058) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... miR-24-3p LNA inhibitor treatment: Cells were transfected with hsa-miR-24-3p miRCURY LNA miRNA Power Inhibitor (Qiagen, Germantown ...
-
bioRxiv - Genomics 2021Quote: ... The anti-sense miRCURY LNA miRNA detection probe dre-miR-146b-5p (YD00613622, QIAGEN) was used ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (Qiagen), in the Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for both genomic and subgenomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected with hsa-miR-24-3p miRCURY LNA miRNA Power Inhibitor (Qiagen, Germantown ...
-
bioRxiv - Physiology 2020Quote: ... The custom LNA-modified miR-467a-5p antagonist and a control oligonucleotide were from Qiagen.
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827, Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mir-103 (Qiagen primer Cat. No. YP00204306) was used as reference miRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers targeting miR-451a (QIAGEN, 3624799) and U6 snRNA (v2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hsa-miR-124-3p Locked Nucleic Acid (LNA) power inhibitor and has-miR-124- 3p miRCURY LNA miRNA mimic (Qiagen, Germantown, MD) were resuspended with RNase-free water to 100 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... mHypoE-N46 cells were transfected with a miR-505-5p mimic (miRCURY LNA miRNA mimic, Qiagen) or negative control ...
-
bioRxiv - Cell Biology 2023Quote: ... Two different kits were used for this method depending on the primer set: Rotor-Gene SYBR® Green RT-PCR Kit (Qiagen, 204174) and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine ...
-
bioRxiv - Immunology 2020Quote: ... the miScript Universal Primer was used alongside miR specific miScript primer assays (miR-206 cat. no. MS00001869 and U6 cat. no. MS00033740; Qiagen).
-
bioRxiv - Immunology 2023Quote: ... 25 nM and 50 nM of synthetic hsa-miR-30b or control mimics (50 nM) (Qiagen). At 36 h post-transfection ...
-
bioRxiv - Genetics 2024Quote: ... and the following miRCURY LNA miRNA PCR primer sets (Qiagen, Hilden, Germany): dme-miR-210-3p (YP02104327) ...