Labshake search
Citations for Qiagen :
1 - 50 of 961 citations for Urotensin 2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2020Quote: Membranes were blocked in Blocking Solution (PentaHis Kit, Qiagen, #34460) for 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... and an undisclosed peptide pool inducing CD8+ T lymphocyte stimulation (Qiagen, 2017); rmsHBHA which tubes contain recombinant M ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transfected with 10 nM Malat1 ENE-targeting (ASO) or control (Con) steric blocking ASOs (Exiqon, Qiagen) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K4ac/K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... The target protein was eluted by 0.2 mg/ml FLAG peptide and load to Ni-NTA affinity gel (Qiagen). After washed by Lysis Buffer supplied with 0.02% GDN and 0.004% CHS ...
-
bioRxiv - Microbiology 2020Quote: ... Crystals of Brd4(BD1) with YFV-C (1-10) K4ac peptide were grown from a solution containing 0.2 M sodium chloride (QIAGEN), 0.1 M Tris (pH 7.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled ORC were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer B with 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled Cdt1 were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer D with 10 mM imidazole for 1.5 hr with rotation at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... Obtained fully tryptic peptides were mapped to the secalin and nsLTP sequences in CLC Genomics Workbench v12 (Qiagen, Aarhus, Denmark) using 100% sequence identity to confirm the expression at individual protein levels.
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were blocked for 1 hour at room temperature either with a commercial blocking buffer (QIAGEN, anti RGS HIS6 HRP conjugate kit) or with 5% milk in 0.05% tween TBS buffer ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic DNA was extracted from the control and the peptide-treated frozen cells using the Blood & Cell Culture DNA Midi Kit according to manufacturer’s instructions (Qiagen, ref. no. 13343). A first PCR was performed to amplify the lentiCRISPR sgRNA region using the following primers:
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...