Labshake search
Citations for Qiagen :
1 - 50 of 5320 citations for Tissue Grinders since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... using either disposable tissue grinders (Fisherbrand) or a TissueRuptor (Qiagen), and RNA was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... and then grinded in a homogenization buffer (Bionano Genomics) using a Tissue Ruptor grinder (Qiagen). Nuclei were washed and embedded in agarose plugs ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were homogenised with a Geno/Grinder (SPEX) and RNA isolated using RNeasy columns (Qiagen) following manufacture instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... the tissue was homogenised to a fine powder using a ball mill-type grinder (Tissuelyser II Qiagen, 85300). For the homogenization of the frozen material one liquid nitrogen cooled 5 mm stainless steel metal balls was added to each Eppendorf tube and the frozen material was disintegrated for 1 min at 25 Hz.
-
bioRxiv - Immunology 2024Quote: ... tissues were homogenised in RLT lysis buffer in a Geno/Grinder (SPEX) and RNA isolated using RNeasy columns (Qiagen) following manufacture instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Brain and DRG samples from up to four donors per species were homogenized in Tissue Protein Extraction Reagent (T-PER) supplemented with HALT protease inhibitor and benzonase endonuclease using a Tissue Lyser Mixer Mill Grinder (Qiagen), while serum and CSF were directly diluted in supplemented T-PER ...
-
bioRxiv - Microbiology 2022Quote: ... freshly collected or RNAlater (ThermoFisher Scientific)-preserved sections of the distal small intestine were manually homogenized using a pestle tissue grinder assembly and RNA was extracted using a RNeasy minikit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Vero cells were seeded in 24-well plates and incubated for 24 hours to reach confluency ...
-
bioRxiv - Microbiology 2021Quote: ... during two rounds of 30 sec at 5,000 rpm in a TissueLyser II grinder (Qiagen). Total RNA was extracted using the NucleoSpin 96 kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... All other tissues were homogenized in a SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen); tubes were shaken in 20 sec bursts at 1500 rpm ...
-
bioRxiv - Plant Biology 2022Quote: Grains were homogenized using mortar and pestle with liquid nitrogen while other tissues were homogenized in SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen). For grain samples ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... A motorized tissue homogenizer (Tissue Ruptor, Qiagen) was used to homogenize whole spleen in 1 ml ice-cold RIPA buffer that contained protease and phosphatase inhibitors ...
-
bioRxiv - Physiology 2022Quote: ... Tissue was disrupted via a tissue lyser (Qiagen) for 2 × 2 mins ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissues were ground using the Tissue-lyser (Qiagen), RNA was extracted using the Qiagen RNeasy Plant mini-kit and brought to a final concentration of 70–200 ng/uL ...
-
bioRxiv - Immunology 2021Quote: ... The tissue was lysed using a tissue Lyser (Qiagen), vortex for 1 min at 4–8 °C and incubated for 4 h at −20 °C ...
-
bioRxiv - Physiology 2021Quote: ... Tissue samples were lysed using a Tissue Lyser (Qiagen) in protein lysis buffer supplemented with protease and phosphatase inhibitors (Boston BioProducts) ...
-
bioRxiv - Genetics 2020Quote: ... Tissue was homogenized in a Tissue Lyser II (Qiagen) using 5 mm stainless steel bead (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... Fixed tissue sections were homogenized using Tissue Lyser (Qiagen), followed by RNA isolation using RNeasy Plant Micro Kit (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Tissues were ruptured using a Tissue Ruptor homogenizer (Qiagen). Homogenized tissues were clarified using a 100-µm strainer (Scientific Inc. ...
-
bioRxiv - Physiology 2020Quote: ... ~50mg of liver tissue was homogenized (Qiagen Tissue Lyser) while cold in ALT lysis buffer and 10uL of extract with 3 technical replicates used ...
-
bioRxiv - Developmental Biology 2023Quote: ... Tissues were sub-dissected into RNAProtect Tissue Reagent (Qiagen) and placed on ice for 2-5 h until all tissues were collected ...
-
bioRxiv - Plant Biology 2023Quote: ... Tissue was homogenized using a Tissue Lyzer II (Qiagen), 2 times 30sec ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tissue samples were homogenised using a tissue lyser (Qiagen). DNA and RNA for bulk RNA-sequencing and whole exome sequencing (WES ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tissue was lysed using a Tissue Lyser II (Qiagen) with metallic beads for 3 mins at 30Hz ...
-
bioRxiv - Plant Biology 2021Quote: ... Dried shoot tips were ground to a fine powder with a Geno/Grinder (SPEX SamplePrep, Metuchen, NJ, USA) prior to genomic DNA extraction using the DNeasy Plant Mini Kit (QIAGEN Inc., Valencia, CA, USA). After checking the DNA quality using gel electrophoresis ...
-
bioRxiv - Microbiology 2022Quote: ... heart valves and soft tissues were processed by disrupting the tissue using a tissue lyser (Qiagen TissueLyzer ...
-
bioRxiv - Genomics 2019Quote: Brain tissue samples were homogenized using the Tissue-Lyser (Qiagen). Total RNA was extracted with TRI Reagent (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissues were homogenized using a Tissue Lyser (Qiagen cat# 85300), which was run at 30 cycles/sec for 1 minute ...
-
bioRxiv - Genomics 2024Quote: Dissected tissues were immediately submerged in RNAprotect Tissue Reagent (Qiagen) and stored at -80 @ ...
-
bioRxiv - Microbiology 2022Quote: ... Tissue kit (Qiagen) following instructions from the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... (Tissue-Tek, Qiagen), with ≈ 7 µm cryosections ...
-
bioRxiv - Genomics 2021Quote: ... DNeasy Blood & Tissue Kit and QIAamp DNA FFPE Tissue Kit (Qiagen) were used for Genomic DNA extraction of paired FF and FFPE samples respectively.
-
bioRxiv - Biochemistry 2021Quote: ... The tissue was then homogenised using a tissue lyser (Qiagen, #85300). The protein concentration was determined using the Bradford protein dye binding assay (#5000113 + #5000114 ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: ... Tissue disruption was then performed in a Tissue Lyser LT (Qiagen) for 4 min at 50Hz ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tissue for immunoblotting was processed using Qproteome FFPE Tissue (Qiagen 37623).
-
bioRxiv - Immunology 2022Quote: ... we homogenized the tissue using a tissue lyser (Qiagen, Hilden, Germany) before total RNA extraction using an RNeasy kit (Qiagen ...
-
bioRxiv - Zoology 2021Quote: ... and from adult tissue with DNEasy Blood and Tissue kit (Qiagen), using manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Tissue samples were homogenized in PBS in a tissue lyser (Qiagen). After centrifugation the supernatant was collected and the pellet washed twice with PBS and resuspended in deionized sterile water ...
-
bioRxiv - Bioengineering 2023Quote: ... Total tissue DNA was extracted using the DNeasy Tissue Kit (Qiagen). The random oligonucleotide insertions from the enriched AAV library particles were amplified by PCR using the primers 5’–GGAGCTTCTTCTTGGGCTCT–3’ and 5’– AGCGGAGAAGGGTGAAAGTT–3’ ...
-
bioRxiv - Immunology 2023Quote: ... Tissue was digested using a DNeasy Blood and Tissue kit (Qiagen), before purifying DNA as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated from brain tissue (RNeasy Lipid Tissue kit, Qiagen) and stored at - 80°C until use ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we extracted genomic DNA from ethanol-preserved liver tissue using the DNeasy Blood and Tissue kit or the DNeasy Blood and Tissue QIAcube kit (Qiagen). For the high elevation mummy samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 20 μg of grinded tissue were used to extract DNA using the blood and tissue kit or the Gentra Puregene tissue kit (Qiagen) following manufacturer’s instructions ...
-
Cre/LoxP-HBV plasmids generating recombinant covalently closed circular DNA genome upon transfectionbioRxiv - Microbiology 2020Quote: ... DNA was extracted from tissues using the DNeasy Blood & Tissue kit (Qiagen) and tested for the rcccDNA Cre excision products ...
-
bioRxiv - Molecular Biology 2022Quote: ... and from tissues using the DNeasy Blood & Tissue Kit (Qiagen, Manchester, UK), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Tissues homogenates were generated using the Tissue Lyzer II (Qiagen, Gaithersburg, MD). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... primary cultures or fixed tissues using DNeasy Blood and Tissue kit (Qiagen).