Labshake search
Citations for Qiagen :
1 - 50 of 565 citations for TGF beta 4 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Cancer Biology 2023Quote: ... Profiling of TGF-β targets was performed using the RT2 Profiler™ PCR Array Pig TGF-β Signaling Targets kit from Qiagen following manufacturers’ instructions.
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Tissues were homogenized in Buffer RLT+ beta-mercaptoethanol (Qiagen). Tissue homogenate was then centrifuged through a QIAshredder homogenizer (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... and beta-mercaptoethanol using the TissueLyser II (Qiagen, Australia). DNA was extracted using the AllPrep DNA/RNA Mini Kit following the manufacturer guidelines (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Microbiology 2020Quote: ... coli 10-beta cloning strain were purified using the standard QIAprep protocol (QIAGEN), then delivered to the Pseudomonas strain via previously published electroporation83 or conjugation84 protocols ...
-
bioRxiv - Genetics 2020Quote: ... with beta-actin as a reference gene (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Immunology 2023Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (–80°C) ...
-
bioRxiv - Bioengineering 2022Quote: RNA was isolated from hBSMC microtissues that were either untreated or treated with TGF-β1 and IL-13 for 7 days prior to RNA isolation using the RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Genomics 2021Quote: ... Then 37.5μl of beta-mercaptoethanol (0.375% final) and 10μl RNAse A (Qiagen® 100mg/mL) were added ...
-
bioRxiv - Cell Biology 2020Quote: Membranes were blocked in Blocking Solution (PentaHis Kit, Qiagen, #34460) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in RLT (with 143mM beta-mercaptoethanol) and RNA purified using the RNeasy kit (Qiagen). 0.8-2μg of RNA were reverse transcribed using the High-Capacity cDNA reverse transcription kit and quantitative real-time PCR was carried out with the ViiA 7 Real-time PCR system (both Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted in RLT buffer supplemented with beta-mercaptoethanol and processed with the RNeasy Micro Kit (QIAGEN) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were lysed in RLT buffer with Beta-mercaptoethanol and RNA was extracted using Qiagen RNEasy kit (Qiagen; #74134). Extracted RNA was then converted to cDNA using the one-step qSCRIPT cDNA solution ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Immunology 2021Quote: ... and an undisclosed peptide pool inducing CD8+ T lymphocyte stimulation (Qiagen, 2017); rmsHBHA which tubes contain recombinant M ...
-
bioRxiv - Plant Biology 2021Quote: ... Fluorescence positive cells were collected in a round-bottom polystylene tube that contains 150 - 200 μl RLT buffer with beta-mercaptoethanol (10 μl / 1 ml RLT buffer, RNeasy micro kit protocol, Qiagen). Cell sorting was performed for about 15 min and collected cells were immediately frozen on dry ice and kept in −80 °C for up to one week ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Developmental Biology 2022Quote: ... from rraga mutants or wildtype siblings were sorted using BD FACSAria II directly into lysis buffer (RLT+beta-mercaptoethanol) from Qiagen RNeasy Micro Kit (74004) ...
-
bioRxiv - Physiology 2021Quote: ... Shredded bone marrow cells were frozen (−80°C) in RLT buffer (1% beta-mercaptoethanol) until RNA extraction using RNAeasy mini kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Synthetic Biology 2023Quote: ... Phoenix-Eco or Phoenix-Eco alpha-V beta-3 were transfected with LZRS-vector constructs using Effectene transfection reagent (Qiagen, 301425) as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were lysed using RLT buffer mastermix (10 uL beta-mercaptoethanol : 1 mL RLT) and cells were lysed with RNAeasy micro kit (Qiagen, 74004). RNA quality and quantity was validated using a nanodrop (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transfected with 10 nM Malat1 ENE-targeting (ASO) or control (Con) steric blocking ASOs (Exiqon, Qiagen) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K4ac/K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Biophysics 2021Quote: ... The target protein was eluted by 0.2 mg/ml FLAG peptide and load to Ni-NTA affinity gel (Qiagen). After washed by Lysis Buffer supplied with 0.02% GDN and 0.004% CHS ...
-
bioRxiv - Microbiology 2020Quote: ... Crystals of Brd4(BD1) with YFV-C (1-10) K4ac peptide were grown from a solution containing 0.2 M sodium chloride (QIAGEN), 0.1 M Tris (pH 7.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled ORC were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer B with 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled Cdt1 were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer D with 10 mM imidazole for 1.5 hr with rotation at 4°C ...