Labshake search
Citations for Qiagen :
1 - 50 of 1243 citations for Siglec 2 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... human primary monocytes were transfected with 200 nM of ON-TARGETplus SMARTpool siRNA targeting Siglec-1 (Horizon Discovery) or non-targeting siRNA (control) using HiPerfect transfection system (Qiagen). Four hours post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...