Labshake search
Citations for Qiagen :
1 - 50 of 499 citations for Siglec 15 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... human primary monocytes were transfected with 200 nM of ON-TARGETplus SMARTpool siRNA targeting Siglec-1 (Horizon Discovery) or non-targeting siRNA (control) using HiPerfect transfection system (Qiagen). Four hours post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1.0–3.0 μl (5.0–15 pmol) of primers and 7.5–15 μl of 2x Multiplex PCR Plus Master mix (QIAGEN). The PCR protocol consisted of an initial DNA polymerase (HotStar Taq ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 15 min of DNase I (Qiagen) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A selection of four candidate markers were tested for polymorphism and sex-linkage using 15 adult males and 15 adult females in two Multiplex PCR Kit reactions (Qiagen; see Supplemental Table 1 for primer sequences and Supplemental Table 2 for PCR conditions) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from frozen ground young leaf using the BioSprint 15 Plant Kit on the BioSprint 15 Workstation (Qiagen, Crawley ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Developmental Biology 2023Quote: ... and eluted in 15 μl Buffer EB (QIAGEN). 1 ng of pre-amplified cDNA was used for the tagmentation reaction (55C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Molecular Biology 2020Quote: ... approximately half of the infected tissue was cut into small pieces and DNA was extracted using a BioSprint 15 instrument and BioSprint 15 DNA plant kit (Qiagen, Australia) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR analysis was performed using 15 ng of cDNA to a final volume of 15 μL reaction with Rotor-Gene SYBR® Green PCR Kit (Qiagen), in a Rotor Gene-Q (R ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Bioengineering 2022Quote: Decellularization for porcine AECMs met the stringent criteria for decellularized ECM.15 Residual dsDNA content was quantified from 15 mg of powdered ECM using the QIAamp DNA Mini Kit (QIAgen, Germantown, MD) followed by Qubit 2.0 (ThermoFisher Scientific ...