Labshake search
Citations for Qiagen :
1 - 50 of 347 citations for Rubella Virus VLP strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: The DNA of VLPs was extracted following the manufacture’s protocol for the QIAampMinElute Virus Spin Kit (QIAGEN). The resulting DNAs were quantified (Qubit ...
-
bioRxiv - Microbiology 2023Quote: DNase/RNase treated VLPs were used for genomic DNA extraction using Qiagen QIAamp DSP Virus Spin Kit (Qiagen, MD, U.S.A) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA of rescued virus strains was extracted with QIAmp DSP viral RNA mini kit (Qiagen), reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Virus RNA virus was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... coli bacteria (XL1Blue strain or DH5α strain) using plasmid extraction kits (QIAGEN; Venlo ...
-
bioRxiv - Immunology 2023Quote: ... coli strain M15 (Qiagen), and recombinant proteins were produced from the E ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... QIAsymphony DSP virus/pathogen Kit (Qiagen) for blood samples ...
-
bioRxiv - Microbiology 2023Quote: ... with EZ1 DSP Virus kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... using Virus Extraction Mini Kit (Qiagen). The RT-qPCR assay were performed with a SuperScript III Platinum One-Step RT-qPCR Kit with ROX (Invitrogen - Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was purified from 280 μl VLP-containing supernatant using a QIAamp viral RNA (vRNA) Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from virus supernatants using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qPCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from SIV and SIVΔNef virus stocks with the QIAamp UltraSens Virus kit (Qiagen, Germantown, MD), reverse transcribed with the Superscript VILO kit (Thermofisher ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain M15 [pREP4] (Qiagen) containing a pQE-30 derivative encoding His6-PA1048 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli strain M15 [pREP4] (Qiagen) containing pAJD2948 was grown in 500 mL of LB broth at 37°C to an OD600 of 0.6-1.0 ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain M15 [pREP4] (Qiagen) containing plasmid pAJD3179 encoding His6-PA3978 was grown in LB broth to mid-log phase at 37°C with aeration ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain M15 [pREP4] (Qiagen) containing a plasmid pQE-30 protein-encoding derivative was grown in LB broth to mid-log phase at 37°C with aeration ...
-
bioRxiv - Microbiology 2019Quote: ... with the Virus Mini Kit v2.0 (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... ZIKA Viral RNA was isolated from Zika virus stock using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704) to create a standard curve using serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Microbiology 2022Quote: ... copies were extracted from plasma virus using the Qiagen BioRobot EZ1 Workstation with EZ1 Virus Mini Kit v2.0 (Qiagen). Eluted vRNA was subsequently used as a template for cDNA synthesis and reverse-transcribed using the reverse primer SHIV.Env.R1 (5’-TACCCCTACCAAGTCATCA-3’ ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was extracted from 10 ul of the purified virus using the MinElute Virus Spin Kit (Qiagen Cat#57704), and the viral genome titer was determined by qPCR using an AAV2 rep gene specific primer probe set (repF ...
-
bioRxiv - Genetics 2020Quote: ... Total viral RNA was extracted from patient specimens and tested for the presence of SARS-CoV-2 with an EZ1 virus extraction kit and EZ1 Advanced XL instrument with the Virus card (Qiagen), or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... For next generation sequencing RNA from virus-containing samples were extracted using the QIAsymphony DSP Virus/Pathogen mini kit (Qiagen). RNA was DNase-treated using the TURBO-free Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Whole genome sequencing of the isolated virus was done isolating viral RNA using the QIAamp MinElute Virus Spine kit (Qiagen) and performing Illumina sequencing ...
-
bioRxiv - Genetics 2022Quote: ... The QIAamp MinElute Virus Spin Kit (QIAGEN, Germany) was used for viral nucleic acid extraction ...
-
bioRxiv - Genetics 2020Quote: ... or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... QIAamp MinElute virus spin kit (Qiagen Sciences, Maryland, MD) was used to extract total nucleic acids from each wastewater sample as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and a dedicated kit (QIAsymphony DSP Virus/Pathogen, Qiagen). All the extracts were stored at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... Equine arteritis virus (EAV) in AVL lysis buffer (Qiagen) was spiked into the reagent as internal control for extracellular RNA samples ...
-
bioRxiv - Microbiology 2021Quote: ... Virus RNA was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... using the “QIAamp Min ELUTE Virus Spin” Kit (QIAGEN), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... using the QIAamp 96 Virus kit QIAcube HT (Qiagen). To detect SARS-CoV-2 RNA ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was extracted from the challenge virus inoculum and virus-positive clinical samples using the QIAamp viral RNA mini kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... using the EZ1 Virus Mini Kit v2.0 (Qiagen Hilden, Germany) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... and QiaAmp 96 Virus QiaCube HT kit (Qiagen, Cat. 57731). RT-PCR reaction was setup using SensiFast Probe No-ROX One- Step Kit (Bioline ...
-
bioRxiv - Genetics 2019Quote: ... We extracted whole genome DNA of YPS128 strain and RM11-1a strain using the QIAamp DNA Mini Preparation Kit (Qiagen), prepared Nextera DNA library (Illumina ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from an overnight culture of the mutant bacterial strain along with the WT strain using DNeasy PowerSoil Pro kit (QIAGEN), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The genomic DNA was extracted from the final resistant strains and the corresponding antibiotic-free strains utilizing the DNeasy Blood and Tissue Kit (Qiagen). Libraries were constructed using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated and purified from the final stable resistant strains and their corresponding antibiotic-free strains using the RNeasy Protect Bacteria Kit (Qiagen). For RNA-Seq analysis ...
-
bioRxiv - Microbiology 2022Quote: ... coli strains containing expression plasmid pQE-9 (Qiagen), pQE9-ftsA ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated using EZ1 Virus Mini Kit v2.0 (QIAGEN). Quantification of viral RNA was performed using a real-time RT-PCR assay specific for HTNV nucleocapsid coding region in a LightCycler® 96 (Roche ...
-
bioRxiv - Immunology 2020Quote: ... from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... Virus was inactivated by mixing 1:1 with Buffer ATL (Qiagen) prior to viral RNA extraction from NP swabs ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted using the QIAamp MinElute Virus Kit (Qiagen, #57704). Purified DNA was eluted in 50μl of Ultra-Pure Water (UltraPure™ DNase/RNase-Free Distilled Water ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using QIASymphony DSP Virus Pathogen Midi kit (Qiagen) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from 3 mL overnight cultures of each strain (see Strains Cultivation) using the DNeasy PowerSoil Pro Kit from Qiagen (Hilden, Germany) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... aeruginosa strains using the QIAamp DNA Mini Kit (Qiagen) according to manufacturers’ instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from whole brain tissue from 3 biological replicates per strain for 45 strains of the HRDP using QIAzol (Qiagen, Valencia, CA, USA). The brain was split sagitally and half of the brain was used for RNA sequencing ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Plant Biology 2021Quote: ... Virion DNA was isolated using QIAamp MinElute Virus Spin Kit (Qiagen, Maryland).