Labshake search
Citations for Qiagen :
1 - 50 of 762 citations for Rh Family C Glycoprotein RHCG Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA for Family 1100 and Family 2100 was extracted with the MagAttract HMW DNA Kit (Qiagen) from whole blood samples of individuals enrolled in a human subjects research protocol approved by the New York University Grossman School of Medicine Institutional Review Board.
-
bioRxiv - Genomics 2020Quote: ... gondii RH Δ ku80 using RNeasy Mini Kit (Qiagen) following manufacturer’s Quick-Start protocol with the DNase digestion step ...
-
bioRxiv - Developmental Biology 2021Quote: DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ...
-
bioRxiv - Biophysics 2020Quote: Genomic DNA from Pitohui uropygialis meridionalis (Family Oriolidae) blood and tissue was extracted using DNeasy kits (Qiagen) to create whole genome sequence libraries for the poisonous Pitohui birds ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression of different fos family genes in zebrafish was analyzed using Quantitect™ Primer Assays (Qiagen) for each individual gene – fosaa ...
-
bioRxiv - Cell Biology 2019Quote: ... GGA family member and interactor targeting siRNAs (Oligo IDs indicated in Fig. S1A) and control siRNA were purchased from Qiagen. Before plating MDA-MB-231 cells on CSMA ...
-
bioRxiv - Genomics 2019Quote: Total RNA was extracted from leaf tissues collected from homozygous resistant and susceptible families and the two parents using the RNeasy Plant Mini Kit (QIAGEN) according to the manufacture’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was isolated from various tissue samples collected from patients and their family members with a Gentra DNA extraction kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 4A-C and 5A-C were lysed in buffer RLT (Qiagen). The cell solution/suspension? was homogenised using QIAshredder columns (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Genetics 2019Quote: ... 59°C for 180 s and 72°C for 30 s (Qiagen Multiplex kit handbook ...
-
bioRxiv - Genetics 2021Quote: ... and end-point PCRs were performed following 34 cycles (94 C 30 sec, 58 C 30 sec, 72 C 1 min) using the HotStarTaq Plus DNA polymerase (Qiagen, Canada) according to manufacturer’s protocol.
-
bioRxiv - Genomics 2021Quote: ... and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2019Quote: ... were frozen at −80°C and subsequently digested at 56°C overnight by Proteinase K (10mM in Tris-HCl, 19133, Qiagen). To account for potentially differential cell proliferation rate between treatments all the ATP quantifications were normalized to DNA content in the same samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Eluates were then treated with Proteinase K (45°C, 1400rpm, 4h) and RNaseA (37°C, 1400rpm, 30min) before cleanup using MiniElute PCR Purification kit (Qiagen). Purified DNA together with input samples before immunoprecipitation were amplified using qPCR SyBr green mix (PCR Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... and stored at −20°C until midiprepped (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2022Quote: ... 4°C) and stored at −80°C before metagenomic extraction using the DNeasy PowerSoil kit following manufacturer specifications (QIAGEN, Hilden, Germany). All sampling and sample processing was conducted following cold chain principles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Plant Biology 2022Quote: Total root RNA was extracted from plantlets grown in vitro at 22 °C and 10 °C using the RNeasy®Plant Mini Kit (QIAGEN, Germany). One microgram of total RNA was reverse transcribed using an oligo(dT)20 primer and the Super Script™ IV RT (lnvitrogen,USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...