Labshake search
Citations for Qiagen :
1 - 50 of 1854 citations for Recombinant Human Interleukin 1 Beta since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Immunology 2023Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (–80°C) ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Tissues were homogenized in Buffer RLT+ beta-mercaptoethanol (Qiagen). Tissue homogenate was then centrifuged through a QIAshredder homogenizer (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... and beta-mercaptoethanol using the TissueLyser II (Qiagen, Australia). DNA was extracted using the AllPrep DNA/RNA Mini Kit following the manufacturer guidelines (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant GST-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 66,030 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant MBP-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 89,590 cm-1 M-1) ...
-
bioRxiv - Plant Biology 2021Quote: ... Fluorescence positive cells were collected in a round-bottom polystylene tube that contains 150 - 200 μl RLT buffer with beta-mercaptoethanol (10 μl / 1 ml RLT buffer, RNeasy micro kit protocol, Qiagen). Cell sorting was performed for about 15 min and collected cells were immediately frozen on dry ice and kept in −80 °C for up to one week ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Physiology 2021Quote: ... Shredded bone marrow cells were frozen (−80°C) in RLT buffer (1% beta-mercaptoethanol) until RNA extraction using RNAeasy mini kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were lysed using RLT buffer mastermix (10 uL beta-mercaptoethanol : 1 mL RLT) and cells were lysed with RNAeasy micro kit (Qiagen, 74004). RNA quality and quantity was validated using a nanodrop (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant proteins were purified on Ni-NTA columns (1 ml Ni-NTA Agarose; Qiagen Cat # 30210), washed with 20 ml hexokinase buffer (20 mM HEPES ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant plasmids were then isolated (MiniPrep, Qiagen) and sequenced (DNA Sequencing Facility ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2020Quote: ... coli 10-beta cloning strain were purified using the standard QIAprep protocol (QIAGEN), then delivered to the Pseudomonas strain via previously published electroporation83 or conjugation84 protocols ...
-
bioRxiv - Genetics 2020Quote: ... with beta-actin as a reference gene (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Genomics 2021Quote: ... Then 37.5μl of beta-mercaptoethanol (0.375% final) and 10μl RNAse A (Qiagen® 100mg/mL) were added ...
-
bioRxiv - Plant Biology 2021Quote: ... recombinant protein and purified using Ni-NTA resin (Qiagen). Polyclonal antibodies were raised in mice as described in 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant protein was purified using Ni-NTA agarose (Qiagen). Rabbit polyclonal antibodies were generated by Covance ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... recombinant proteins were purified using Ni-NTA Agarose (Qiagen 30210). Buffer was exchanged by dialysis to PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Recombinant proteins were purified using Ni-NTA affinity resin (Qiagen) according to standard protocols (21) ...
-
bioRxiv - Biophysics 2023Quote: ... The recombinant proteins were purified using nickel affinity chromatography (Qiagen). As the final purification step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant proteins were then purified by Ni-NTA-agarose (Qiagen) affinity chromatography ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in RLT (with 143mM beta-mercaptoethanol) and RNA purified using the RNeasy kit (Qiagen). 0.8-2μg of RNA were reverse transcribed using the High-Capacity cDNA reverse transcription kit and quantitative real-time PCR was carried out with the ViiA 7 Real-time PCR system (both Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins were purified with Ni-NTA chromatography (Ni2+-nitrilotriacetate, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant protein was initially purified by nickel affinity chromatography (Qiagen, Holland) and subsequent size exclusion using Superdex 200 increase (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Immunology 2023Quote: ... Recombinant protein was purified by binding to Ni-NTA beads (Qiagen) and eluted in the same buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted in RLT buffer supplemented with beta-mercaptoethanol and processed with the RNeasy Micro Kit (QIAGEN) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant protein was purified by Ni-NTA affinity chromatography column (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... Recombinant protein in the supernatant was purified via Ni2+-NTA (Qiagen, UK) column [20].
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were purified from lysates on Ni-NTA columns (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...