Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Rat Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... elegans using the RNeasy kit (QIAGEN). First-strand cDNAs were generated with the ThermoScript RT-PCR system using an anc-1 antisense oligonucleotide (ods2572 ...
-
bioRxiv - Cell Biology 2021Quote: ... elegans embryos using a RNeasy Extraction Kit (Qiagen) and converted into cDNA using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... elegans using the Gentra Puregene Tissue Kit (Qiagen) and genomic DNA libraries were prepared using the NEBNext genomic DNA library construction kit (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... elegans genomic DNA was extracted using Gentra Puregene Tissue Kit (Qiagen, #158667) and DNA library preparation was performed using NEBNext Ultra II FS DNA Library Prep with Sample Purification Beads Kit (NEB ...
-
bioRxiv - Genomics 2023Quote: Total DNA from enhancer screening library transduced HUDEP-2 cells was isolated using the DNeasy Blood & Tissue kit (Qiagen, 69504) and the enhancer inserts were PCR amplified using the following primers:
-
bioRxiv - Neuroscience 2023Quote: ... 12 µL of Enhancer (Qiagen), 16 µg of plasmid and 15 µL of Effectene (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... elegans lysis and genomic DNA purification were performed using the DNeasy Blood and Tissue kit (Qiagen). Animals from two recently starved populations were collected ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by adding 8 µl Effectene Enhancer (Qiagen), vortexing and incubation for 5 min ...
-
bioRxiv - Genomics 2019Quote: ... elegans early embryos were purified using RNeasy Minikit (Qiagen NV, Venlo, the Netherlands). Purified mRNAs were reverse-transcribed into cDNAs ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2023Quote: ... was used for searching CJIE1 H-fiber homologs in our CAMSA bacterial collection and sequences were further aligned using CLC Main Workbench 22 (QIAGEN). To analyse the MOMP diversity ...
-
bioRxiv - Genetics 2022Quote: ... elegans N2 strain genomic DNA with Phusion HF polymerase (New England Biosciences) and gel purified (Qiagen). Enhancer fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 40mM Tris-HCl ph 6.5 for 2 hour at 45°C prior to purification with QIAquick PCR Purification Kit (Qiagen). For ‘input’ DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1h at 37 °C (2 units per sample) followed by purification with the RNeasy miniElute Cleanup kit (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... ConM-SOSIP.v7 carrying a C-terminal His-tag (diluted to 6.5nM in TBS) was immobilized onto 96-well Ni-NTA ELISA plates (Qiagen) by incubation for 2 hours at room temperature after which the plates were washed 3 times with TBS ...
-
bioRxiv - Genomics 2022Quote: ... 25 fmol of the exogenous synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples at the beginning of the extraction procedure to check both the extraction of miRNAs and the efficiency of the cDNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR fragments were incubated with DpnI for 2 h at 37°C to degrade the template plasmids before being purified using a PCR purification kit (Qiagen). The purified PCR fragments were digested overnight at 37°C using NheI and XhoI and ligated overnight at 16°C to backbone vector pYZ125 ...
-
bioRxiv - Microbiology 2019Quote: ... sorted cells were incubated for 2 h at 55 °C and genomic DNA was extracted using Blood and Tissue DNA extraction kit (Qiagen), by omitting the lysis step ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... The mixture was incubated at 16°C for 2 h and the resulting double-stranded DNA was purified using the MinElute PCR Purification kit (Qiagen) with 20μl EB for elution ...
-
bioRxiv - Microbiology 2023Quote: ... The homogenate was treated overnight with proteinase K (2 mg/ mL) at 56 °C and DNA was extracted using the MagAttract PowerSoil DNA EP Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Genetics 2023Quote: ... Digests were incubated for 2 hours at 37°C then purified using a QiaQuick PCR purification kit (Qiagen Cat#28106). Fragments of 2100 bp were size-selected using a SageELF instrument (Sage Science ...
-
bioRxiv - Genetics 2021Quote: Multi-array ELISA was performed using the Multi-Analyte ELISArray Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Neuroscience 2023Quote: ... After protein digestion (PK Buffer and Proteinase K (20 mg/mL) for 2 hrs at 45°C) DNA was purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to manufacturer instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Genomics 2022Quote: ... The sample was incubated at room temperature for 5 min and 3.75μL (25 fmol final concentration) of the synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Immunology 2021Quote: ... The dried DNA pellet was reconstituted in 50 μL H2O treated with 330 μg/mL of RNase A for 2 hours at 37°C and then recovered using the QIAquick PCR Purification kit (QIAGEN Cat#28104). DNA concentration was determined by Qubit (Thermofisher).
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was treated with proteinase K at 42°C for 2 hrs and purified using MinElute PCR Purification Kit (Qiagen, Cat# 28004).
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNAs were isolated from cerebral cortices (P15 rats) using Mini RNeasy kit (Qiagen) then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: SARS-CoV-2 ELISA was developed in-house using His tagged proteins bound on Ni-NTA HisSorb Strips or Plates (Qiagen). ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both the input and IP samples were incubated at 50°C for 2 hr and then cleaned up using the Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany, Cat # 28104) and eluted in 35 μL of water.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was isolated from rat blood cells using QIAmp DNA Mini Kit (Qiagen, City, state) following manufacturer’s instructions using a QIAcube automated device ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...