Labshake search
Citations for Qiagen :
1 - 34 of 34 citations for PD L2 Cynomolgus HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: HEK 293 cells were transfected using PolyFect Transfection Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was prepared from transiently transfected HEK 293 cells using RNeasy Mini Kit (Qiagen) or TRIzol reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... doxycycline-inducible HEK-293 cells was isolated using the RNeasy Mini kit (Qiagen, Germantown, MD, USA). The isolated RNA was processed via reverse-transcription (RT)-PCR and Ψ (percent spliced in ...
-
bioRxiv - Cell Biology 2023Quote: ... stably transduced HEK 293 cells or whole kidneys was extracted using the RNeasy kit (Qiagen, Valencia, CA) with subsequent DNase I treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted from HEK-293 cells or kidney tissues using the QIAamp DNA Mini kit (QIAGEN) and treated with sodium bisulfite using the EZ DNA Methylation kit (Zymo Research ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from HEK 293 cells with DNeasy Blood & Tissue Kit (Qiagen, Cat. No. / ID:69504) and PCR amplified with primers specific for the investigated ISL1 region (primers list in supplementary information) ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cell Biology 2019Quote: ... and from control and CLN6−/− HEK-293T cells using the RNEasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: RNA from Flp-In™293 cells was extracted using the RNeasy kit (Qiagen) in accordance with the manufacturer’s instructions that included the genomic DNA digestion with DNaseI (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: ... The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen). After virus rescue was observed via plaque formation ...
-
bioRxiv - Microbiology 2021Quote: ... Transient transfections of HEK-293T cells were performed using PolyFect transfection reagent per manufacturer instructions (Qiagen). For transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK-293T cells transfected with the desired plasmids by using Attractene Transfection Reagent (301005, QIAGEN, Hilden, Germany), according to the fast-forward protocol ...
-
bioRxiv - Cancer Biology 2022Quote: The DNA was extracted from HEK-293T cells using the DNeasy Blood & Tissue Kit from QIAGEN (#69504). The Samples were prepared and sequenced in Bio Basic Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK 293FT cells were transfected using calcium phosphate method and U2OS cells using Effectene Transfection Reagent (Qiagen). To induce primary cilia ...
-
bioRxiv - Cell Biology 2021Quote: ... The genomic DNA (gDNA) of these HEK-293FT cells was isolated using DNeasy Blood & Tissue Kits (Qiagen, no. 69504). The gDNA was further analyzed by qPCR targeting the barcode and the endogenous gene BMP2 using the QuantiNova SYBR Green PCR kit (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... RNA samples from heart tissue and HEK and CHO cell pellets were purified using a RNeasy mini kit (Qiagen). RNA was reverse-transcribed to cDNA using an Applied Biosystems High-Capacity RNA-to-cDNA kit (Foster City ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK-293T cells were next transfected with pMMP vectors together with retrovirus packaging plasmids using Effectene transfection reagents (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from HEK 293T or CASP1−/− MV4;11 cells at the end of the experiment using the RNeasy Mini Kit (Qiagen) and reverse transcription-PCR was performed on 0.8 µg of mRNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNAs were isolated from the A549 cells transfected with PD-L1-lnc overexpressed vector or control vector by TRIzol reagent and purified by RNeasy Mini Kit (Qiagen, USA). RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: For biotinylated RIPs HEK-293T cells were seeded and transfected with 20nM biotinylated LNA miR-29b or miR-30c (Qiagen) in combination with 2 μl Lipofectamine RNAi Max (ThermoFisher) ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Genetics 2022Quote: ... the PCR fragment and the plasmid fragment without PDS gene were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen, catalog number 28706). The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... This construct was co-transfected with the pVSV-G retroviral coat protein expression vector into GP2-293 packaging cells using Effectene (Qiagen Sciences, Inc.; Germantown, MD). At 24 h and again at 48 h post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... selected by p value and/or fold change (FC) as indicated were uploaded into the IPA software (Qiagen). The Core Analyses function included in the software was used to interpret the data for top canonical pathways.
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Immunology 2021Quote: ... adherent cells were collected and either analyzed by FC or subjected to RNA isolation using the RNeasy Mini Kit (Qiagen #74106).
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...