Labshake search
Citations for Qiagen :
1 - 50 of 340 citations for PD L1 Cynomolgus HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNAs were isolated from the A549 cells transfected with PD-L1-lnc overexpressed vector or control vector by TRIzol reagent and purified by RNeasy Mini Kit (Qiagen, USA). RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... and HRP-anti-His (Penta-His Ab, Qiagen) was used in the detection step ...
-
bioRxiv - Molecular Biology 2019Quote: ... penta-HIS (QIAGEN) or α-RF1 E.coli (Zaher Lab ...
-
bioRxiv - Cell Biology 2021Quote: ... penta-His (Qiagen). Membranes were then incubated with fluorophore-conjugated secondary antibodies diluted 1:20,000 in TBS-T and 5% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized L1 ORF0 sequence generated by Miniprep (Qiagen). 8nM EN WT and inhibitors or vehicle were incubated at room temperature for 1 hour before adding 2nM plasmid ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Plant Biology 2022Quote: ... bound His-mSTIC2 protein was detected by anti His HRP conjugate (Qiagen) and ECL reaction (Pierce).
-
bioRxiv - Cell Biology 2020Quote: ... Penta-His from QIAGEN; CD63 (clone H5C6 ...
-
bioRxiv - Microbiology 2020Quote: ... His-Penta-Conjugate (Qiagen) was then used as the secondary antibody (1:5000) ...
-
bioRxiv - Immunology 2020Quote: ... and detection was performed using anti-His antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... His-EHD1 was purified by binding with Ni2+-NTA His-bind slurry (Qiagen, Germany) and eluting with imidazole as described previously (65) ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Cell Biology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... and anti-His (Qiagen 34660) antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-RGS-His (Qiagen, 34610), anti-Vinculin (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-penta-His (34660, Qiagen), anti-GFP-HRP (B-2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His (Qiagen 34660) antibodies ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Microbiology 2019Quote: ... and HRP-penta-His antibody (Qiagen) and HRP-anti-mouse IgG (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Microbiology 2019Quote: ... Penta His HRP conjugate (Qiagen, 34460) was diluted 1:5000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN, Cat. No. 30210) according to the product protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Biochemistry 2023Quote: ... Cleaved CK1δ ΔC was further purified away from His-GST and His-TEV using Ni-NTA resin (Qiagen) and subsequent size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... the Penta-His HRP Conjugate Kit (Qiagen) was used following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... The Penta-His HRP Conjugate Kit (Qiagen) was used for detection of His-tagged proteins according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...