Labshake search
Citations for Qiagen :
1 - 12 of 12 citations for PD L1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNAs were isolated from the A549 cells transfected with PD-L1-lnc overexpressed vector or control vector by TRIzol reagent and purified by RNeasy Mini Kit (Qiagen, USA). RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized L1 ORF0 sequence generated by Miniprep (Qiagen). 8nM EN WT and inhibitors or vehicle were incubated at room temperature for 1 hour before adding 2nM plasmid ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was extracted from D0 and D7 3T3-L1 cells using an RNeasy Plus Mini Kit (Qiagen #74134). RNA concentration was measured by NanoDrop (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... 3-5 positive colonies per L1 element were chosen for Miniprep culture and plasmid DNA was isolated using QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from 3T3-L1 preadipocytes (day 0) and differentiated adipocytes (day 5) using DNeasy Tissue kit (Qiagen). Two µg of each DNA sample was bisulfite modified using EpiTect Bisulfite kit (Qiagen) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 100 mg leaf samples of stressed and unstressed plants [three replicates of each control (WT) and transgenic (L1) plants] using the RNeasy Plant Mini kit (Qiagen, Germany). Sequentially first strand cDNA ...
-
bioRxiv - Genomics 2022Quote: ... At least 3 positive colonies per L1 were chosen for Miniprep culture and plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Cat#: 27106). At least three clones per element were capillary sequenced and compared to identify PCR-induced mutations ...
-
bioRxiv - Genetics 2022Quote: ... the PCR fragment and the plasmid fragment without PDS gene were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen, catalog number 28706). The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs ...