Labshake search
Citations for Qiagen :
1 - 50 of 836 citations for NT 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... or non-targeting siRNA (NT; Qiagen 1027280), or alternatively ...
-
bioRxiv - Neuroscience 2022Quote: ... or non-targeting (NT) control (Cat#339515) (Qiagen), were added to the co-culture during the media replacement ...
-
bioRxiv - Biochemistry 2020Quote: ... NT-hFMRP was purified using Ni-NTA affinity chromatography (Qiagen). GST-hFMRP RGG ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA over 200 nt was first isolated using RNeasy kit (Qiagen). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... Less than 200 nt fragments were collected using miRelute column (QIAGEN). 2pmol of oligo DNA (5’-AGTCTTACAACCCTCAACCATATGTAGTCCAAGCAGCACT-3’ ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Product longer than 100 nt was recovered using QIAquick Gel Extraction Kit (Qiagen) after separation of the ligation products with TBE-Urea 10% Gel (Invitrogen) ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2021Quote: ... and small RNAs (< 200 nt) were discarded using the RNeasy MinElute Cleanup Kit (Qiagen). For the generation of TSS cDNA libraries ...
-
bioRxiv - Biophysics 2019Quote: ... the 69 nt gap DNA substrate was gel purified by QIAquick Gel Extraction Kit (Qiagen), as described.33 The final product consists of 69 nt ssDNA flanked with 441 bp and 235 bp dsDNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Genetics 2019Quote: ... and the 140–160 nt length bands were excised and purified using MiniElute Gel Extraction kit (Qiagen). Libraries were run on an Illumina NextSeq500 sequencer.
-
bioRxiv - Evolutionary Biology 2023Quote: RNA (>200 nt) and small RNA were isolated using the miRNeasy Mini Kit (Qiagen, cat. no. 217004) and RNeasy® MinElute® Cleanup Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Plant Biology 2019Quote: ... After adapter clipping FASTQ files of the raw reads with a length of 18 to 26 nt were loaded into the CLC Genomics Workbench 11.0.1 (Qiagen) for further analyses ...
-
bioRxiv - Cancer Biology 2020Quote: RNA from 18 nucleotides (nt) upwards was extracted from 106 cells homogenized in QIAzol Lysis Reagent (Qiagen, #79306) and using the miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 293A cells were transfected with the plasmid of pCDNA3.1-ACE2 (human)-3×FLAG (MiaoLing Plasmid Platform, China) using polyfect (QIAGEN, West Sussex, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... The desired band at the size of 1,301 nt was cut out and purified using QIAquick Gel Extraction Kit (Qiagen). For the run on the PacBio SMRT cell ...
-
bioRxiv - Molecular Biology 2019Quote: ... Small RNAs shorter than 200 nt were then removed from the poly(A) RNA using the RNeasy kit (Qiagen). This size selection was performed to prevent detection of extended cap structures that are known to be present in certain small RNAs ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 6337 bp product with a 63 nt-gap was then purified with a PCR purification kit from QIAGEN and a 150X excess of Poly(dT)-flap oligonucleotide (Supplementary Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from KMS11 or JJN3 cells treated with NT or ILF2 ASOs using the RNeasy kit (Qiagen). Estimates of gene expression were generated by pseudo-aligning FASTQ files against human genome GRCh38.p12 (Ensembl version 94 ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were resolved on a 2% agarose gel and the fragments migrating within the range of 200 to 330 nt were excised and the DNA was extracted using the Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Bands ranging in length from 140 to 160 nt were carefully excised and purified using the MiniElute Gel Extraction Kit (QIAGEN). The purified samples were once again assessed for quality and concentration using the Agilent 2200 TapeStation ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Biophysics 2021Quote: ... The capture probes contained an 11- to 12-nt target-capturing sequence with 4 LNA residues (Tm = ~70°C, estimated using Qiagen web application) for high affinity and kinetically stable capturing of nucleic acid targets on the surface ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...