Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... genotyping PCR products were purified using MinElute PCR Purification Kit (28006X4, Qiagen), DNA concentration was measured by spectrophotometry ...
-
bioRxiv - Pathology 2020Quote: Genotyping was standardized using PCR amplification (QIAGEN kit ref. 201445). DNA was obtained from ear punch using the KAPA BIOSYSTEMS kit (ref ...
-
bioRxiv - Developmental Biology 2021Quote: ... Animal genotyping PCR (Taq PCR Master Mix, Qiagen) samples were run on either 0.8% or 2.0% agarose gels ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted for PCR genotyping using DNeasy Blood & Tissue Kits (Qiagen), and subjected to targeted deep sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... Genotyping PCR was performed with HotStarTaq Master Mix (Qiagen) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: ... PCR genotyping was repeated on gDNA isolated using the DNeasy Blood and Tissue Kit (Qiagen). To identify the targeted allele ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single and pooled animal genotyping PCR reactions used Taq PCR Master Mix (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: Genotyping was performed by PCR of tail DNA (extracted using the DNA Blood & Tissue kit, QIAgen, according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... Genotyping PCR reaction was performed using HotStar Taq DNA polymerase (Qiagen, 203207), 0.4 uM primers (Microsynth) ...
-
bioRxiv - Cell Biology 2023Quote: ... Genotyping by PCR was carried out using HotStar Taq DNA Polymerase (Qiagen) according to manufacture conditions ...
-
bioRxiv - Genetics 2022Quote: ... All PCR genotyping reactions were performed using Taq DNA polymerase from Qiagen (201205).
-
bioRxiv - Genetics 2022Quote: ... A small number of positive clones were expanded and PCR genotyping was repeated on gDNA isolated using the DNeasy Blood and Tissue Kit (Qiagen) or GeneJET Genomic DNA Purification Kit (Thermo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was isolated using the SampleIN Direct PCR Kit (highQu) or the AllPrep DNA/RNA/Protein Mini Kit (Qiagen), and amplified with ALLin HS Red Taq Mastermix (highQu ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA for PCR-based genotyping and piggyBac copy number analysis by ddPCR was isolated via the DNeasy Blood and Tissue Kit (Qiagen 69504). For doxycycline induction of dCas9-KRAB and dCas9-VPR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annotation of PCR genotyping results was carried out on a QIAxcel Advanced System (Qiagen) and analyzed using QIAxcel ScreenGel software (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... A mouse neurogenesis PCR array kit (#PAMM-404AZA, Qiagen) was employed to measure the mRNA expression of genes involved in this pathway using real-time PCR (ABI 7500) ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA for genotyping was extracted using DNeasy Blood & Tissue Kit (Qiagen). PCR analyses were performed using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... Extracted DNA was used for genotyping by polymerase chain reaction (PCR) (Taq DNA polymerase, Qiagen, Hilden, Germay), using primers flanking the endogenous CAG repeat in exon 10 of the murine Atxn3 gene (primer sequences ...
-
bioRxiv - Physiology 2022Quote: ... Genotyping of SNP markers was performed using high resolution melt curve analysis (Qiagen kit) using the Rotor-gene Q thermocycler (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: Two conventional genomic DNA extraction methods were used in this study for comparison with the direct PCR methods: DNeasy blood and tissue kit (Qiagen) and DNeasy Powersoil kits (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... DNA extraction for genotyping was carried out with the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s guidelines (Purification of Total DNA from Animal Blood or Cells (Spin-Column Protocol) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mRNA was isolated using the Oligotex direct mRNA kit (Qiagen) according to the manufacturer recommendations ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... For cell line genotyping we isolated genomic DNA with QIAamp® DNA Micro Kit (#56304, Qiagen). Primers for genotyping are listed in Supplementary Table S5 ...
-
bioRxiv - Cell Biology 2021Quote: DNA for genotyping was isolated from tails or cells using DNeasy blood and tissue kit (Qiagen). RNA was isolated using the miRNeasy micro or RNeasy micro kits depending on the downstream application ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was isolated for genotyping from G2 pupae using the DNeasy Blood and Tissue Kit (Qiagen). PCR amplicons spanning both BtMFS guide recognition sites were generated using Q5 polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA for regular genotyping and bisulfite sequencing was extracted using the DNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplicons of exon 5 of the mouse Nprl3 gene were purified using a PCR purifications Kit (Qiagen, Hilden, Germany) and sent to the Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core for whole amplicon next-generation sequencing (NGS ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping results were visualized using a QIAxcel instrument (Qiagen).
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping results were visualized with a QIAxcel instrument (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using the Direct-zol RNA MiniPrep Plus Kit (Qiagen) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR products (PCR purification kit, Qiagen) of CHPV and JEV positive samples were sent for sequencing ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification (Qiagen, Taq PCR Core Kit) was used to create more copies with a T7 promoter that was added to the 5’ end of the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR purified (QIAquick PCR Purification kit, QIAGEN), and used in T7 reverse transcription reactions (MEGAscript ...
-
bioRxiv - Microbiology 2023Quote: ... PCR purification (Qiagen QIAquick PCR Purification Kit) was used to isolate the linearized PCR product ...
-
bioRxiv - Neuroscience 2021Quote: DNA for NT213739 genotyping was isolated from frozen livers or cerebellar tissue using the Qiagen DNeasy Kit (Qiagen, #69506) using forward (5′ -CTCCTATTCAGCCCTCAGAAAC-3′ ...
-
bioRxiv - Cell Biology 2023Quote: Genotyping and Sanger sequencing were performed by extracting genomic DNA with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturers’ instructions ...
-
bioRxiv - Genetics 2023Quote: ... PCR product was purified by PCR QIAquick PCR Purification Kit (QIAGEN) and subjected to MiSeq (Center for Computational and Integrative Biology DNA Core ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified (Qiagen PCR purification Kit) and eluted in 50 μl of 0.1 M NaHCO3 solution ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified (Qiagen PCR purification kit) and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR purification kit (QIAGEN) was used for DNA purification after proteinase K treatment for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... direct lysis was performed by adding lysis buffer of the RNeasy Mini Kit (Qiagen) to individual wells ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using PCR purification kit (Qiagen) and digested with restriction enzyme KpnI-HF (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was cleaned (Qiagen MinElute PCR Purification Kit) and resuspended in water at a desired concentration of 1-2 ug/uL as measured by a Qubit 3.0 dsDNA assay (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR samples were amplified using PyroMark PCR kit (Qiagen). PCR products were sequenced using PyroMark Q48 Advanced CpG reagents on a PyroMark Q48 Autoprep instrument (Qiagen) ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... After PCR cleanup with QIAquick PCR Purification Kit (Qiagen), the PCR product was digested with NotI at 37°C for 4 hrs and repurified with a QIAquick PCR Purification Kit ...
-
bioRxiv - Genomics 2019Quote: ... PCR purification was performed using PCR Purification kit (Qiagen). DNA was methylated in vitro using M.SssI methyltransferase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was performed with the PyroMark PCR Kit (QIAGEN) using 100 ng / μL of DNA according to the manufacturer’s protocol ...