Labshake search
Citations for Qiagen :
1 - 50 of 711 citations for Mouse Anti Nipah Virus Glycoprotein F CG11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was subsequently isolated from mouse plasma using the MinElute Virus Kit (Qiagen) on the QiaCube ...
-
bioRxiv - Microbiology 2020Quote: ... Virus RNA virus was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... QIAsymphony DSP virus/pathogen Kit (Qiagen) for blood samples ...
-
bioRxiv - Microbiology 2023Quote: ... with EZ1 DSP Virus kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... using Virus Extraction Mini Kit (Qiagen). The RT-qPCR assay were performed with a SuperScript III Platinum One-Step RT-qPCR Kit with ROX (Invitrogen - Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from virus supernatants using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qPCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from SIV and SIVΔNef virus stocks with the QIAamp UltraSens Virus kit (Qiagen, Germantown, MD), reverse transcribed with the Superscript VILO kit (Thermofisher ...
-
bioRxiv - Microbiology 2019Quote: ... with the Virus Mini Kit v2.0 (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... ZIKA Viral RNA was isolated from Zika virus stock using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704) to create a standard curve using serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Microbiology 2022Quote: ... copies were extracted from plasma virus using the Qiagen BioRobot EZ1 Workstation with EZ1 Virus Mini Kit v2.0 (Qiagen). Eluted vRNA was subsequently used as a template for cDNA synthesis and reverse-transcribed using the reverse primer SHIV.Env.R1 (5’-TACCCCTACCAAGTCATCA-3’ ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was extracted from 10 ul of the purified virus using the MinElute Virus Spin Kit (Qiagen Cat#57704), and the viral genome titer was determined by qPCR using an AAV2 rep gene specific primer probe set (repF ...
-
bioRxiv - Genetics 2020Quote: ... Total viral RNA was extracted from patient specimens and tested for the presence of SARS-CoV-2 with an EZ1 virus extraction kit and EZ1 Advanced XL instrument with the Virus card (Qiagen), or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... For next generation sequencing RNA from virus-containing samples were extracted using the QIAsymphony DSP Virus/Pathogen mini kit (Qiagen). RNA was DNase-treated using the TURBO-free Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Whole genome sequencing of the isolated virus was done isolating viral RNA using the QIAamp MinElute Virus Spine kit (Qiagen) and performing Illumina sequencing ...
-
bioRxiv - Genetics 2022Quote: ... The QIAamp MinElute Virus Spin Kit (QIAGEN, Germany) was used for viral nucleic acid extraction ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... QIAamp MinElute virus spin kit (Qiagen Sciences, Maryland, MD) was used to extract total nucleic acids from each wastewater sample as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and a dedicated kit (QIAsymphony DSP Virus/Pathogen, Qiagen). All the extracts were stored at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... Equine arteritis virus (EAV) in AVL lysis buffer (Qiagen) was spiked into the reagent as internal control for extracellular RNA samples ...
-
bioRxiv - Microbiology 2021Quote: ... Virus RNA was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... using the “QIAamp Min ELUTE Virus Spin” Kit (QIAGEN), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... using the QIAamp 96 Virus kit QIAcube HT (Qiagen). To detect SARS-CoV-2 RNA ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was extracted from the challenge virus inoculum and virus-positive clinical samples using the QIAamp viral RNA mini kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... using the EZ1 Virus Mini Kit v2.0 (Qiagen Hilden, Germany) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... and QiaAmp 96 Virus QiaCube HT kit (Qiagen, Cat. 57731). RT-PCR reaction was setup using SensiFast Probe No-ROX One- Step Kit (Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated using EZ1 Virus Mini Kit v2.0 (QIAGEN). Quantification of viral RNA was performed using a real-time RT-PCR assay specific for HTNV nucleocapsid coding region in a LightCycler® 96 (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Virus was inactivated by mixing 1:1 with Buffer ATL (Qiagen) prior to viral RNA extraction from NP swabs ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted using the QIAamp MinElute Virus Kit (Qiagen, #57704). Purified DNA was eluted in 50μl of Ultra-Pure Water (UltraPure™ DNase/RNase-Free Distilled Water ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using QIASymphony DSP Virus Pathogen Midi kit (Qiagen) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Plant Biology 2021Quote: ... Virion DNA was isolated using QIAamp MinElute Virus Spin Kit (Qiagen, Maryland).
-
bioRxiv - Immunology 2022Quote: ... To sequence the envelope from serum virus we isolated viral RNA (Qiagen), synthesized cDNA ...
-
bioRxiv - Immunology 2020Quote: Plasma RNA was extracted using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR of SIV gag RNA was by QuantiTect Virus kit (Qiagen 211011) or ddPCR using One-Step RT ddPCR Adv kit (Bio-Rad 1864022) ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR of SIV gag RNA was by QuantiTect Virus kit (Qiagen 211011) or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022) ...
-
bioRxiv - Microbiology 2023Quote: ... and recLI9-NS1-GFP11 reporter virus was purified using RNeasy kit (Qiagen). cDNA synthesis was performed as above using random hexamer primers (25°C for 10 min ...