Labshake search
Citations for Qiagen :
1 - 50 of 966 citations for Mouse Anti Human Papilloma virus L1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was subsequently isolated from mouse plasma using the MinElute Virus Kit (Qiagen) on the QiaCube ...
-
bioRxiv - Microbiology 2020Quote: ... Virus RNA virus was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized L1 ORF0 sequence generated by Miniprep (Qiagen). 8nM EN WT and inhibitors or vehicle were incubated at room temperature for 1 hour before adding 2nM plasmid ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Evolutionary Biology 2019Quote: ... QIAsymphony DSP virus/pathogen Kit (Qiagen) for blood samples ...
-
bioRxiv - Microbiology 2023Quote: ... with EZ1 DSP Virus kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... using Virus Extraction Mini Kit (Qiagen). The RT-qPCR assay were performed with a SuperScript III Platinum One-Step RT-qPCR Kit with ROX (Invitrogen - Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from virus supernatants using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qPCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from SIV and SIVΔNef virus stocks with the QIAamp UltraSens Virus kit (Qiagen, Germantown, MD), reverse transcribed with the Superscript VILO kit (Thermofisher ...
-
bioRxiv - Microbiology 2019Quote: ... with the Virus Mini Kit v2.0 (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Immunology 2021Quote: ... ZIKA Viral RNA was isolated from Zika virus stock using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704) to create a standard curve using serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Microbiology 2022Quote: ... copies were extracted from plasma virus using the Qiagen BioRobot EZ1 Workstation with EZ1 Virus Mini Kit v2.0 (Qiagen). Eluted vRNA was subsequently used as a template for cDNA synthesis and reverse-transcribed using the reverse primer SHIV.Env.R1 (5’-TACCCCTACCAAGTCATCA-3’ ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was extracted from 10 ul of the purified virus using the MinElute Virus Spin Kit (Qiagen Cat#57704), and the viral genome titer was determined by qPCR using an AAV2 rep gene specific primer probe set (repF ...
-
bioRxiv - Genetics 2020Quote: ... Total viral RNA was extracted from patient specimens and tested for the presence of SARS-CoV-2 with an EZ1 virus extraction kit and EZ1 Advanced XL instrument with the Virus card (Qiagen), or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... For next generation sequencing RNA from virus-containing samples were extracted using the QIAsymphony DSP Virus/Pathogen mini kit (Qiagen). RNA was DNase-treated using the TURBO-free Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Whole genome sequencing of the isolated virus was done isolating viral RNA using the QIAamp MinElute Virus Spine kit (Qiagen) and performing Illumina sequencing ...
-
bioRxiv - Genetics 2022Quote: ... The QIAamp MinElute Virus Spin Kit (QIAGEN, Germany) was used for viral nucleic acid extraction ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... QIAamp MinElute virus spin kit (Qiagen Sciences, Maryland, MD) was used to extract total nucleic acids from each wastewater sample as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and a dedicated kit (QIAsymphony DSP Virus/Pathogen, Qiagen). All the extracts were stored at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... Equine arteritis virus (EAV) in AVL lysis buffer (Qiagen) was spiked into the reagent as internal control for extracellular RNA samples ...
-
bioRxiv - Microbiology 2021Quote: ... Virus RNA was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... using the “QIAamp Min ELUTE Virus Spin” Kit (QIAGEN), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... using the QIAamp 96 Virus kit QIAcube HT (Qiagen). To detect SARS-CoV-2 RNA ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was extracted from the challenge virus inoculum and virus-positive clinical samples using the QIAamp viral RNA mini kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... using the EZ1 Virus Mini Kit v2.0 (Qiagen Hilden, Germany) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... and QiaAmp 96 Virus QiaCube HT kit (Qiagen, Cat. 57731). RT-PCR reaction was setup using SensiFast Probe No-ROX One- Step Kit (Bioline ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated using EZ1 Virus Mini Kit v2.0 (QIAGEN). Quantification of viral RNA was performed using a real-time RT-PCR assay specific for HTNV nucleocapsid coding region in a LightCycler® 96 (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Virus was inactivated by mixing 1:1 with Buffer ATL (Qiagen) prior to viral RNA extraction from NP swabs ...