Labshake search
Citations for Qiagen :
1 - 50 of 3178 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA (including integrated HIV-1 DNA and episomal HIV-1 DNA) was extracted using the QIAmp blood DNA minikit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... HIV-1 RNA was isolated using the QIAcube (Qiagen) from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Individual integrase plasmids in each strain were collected by miniprep (Qiagen). The RBS region of each was sequenced by Sanger sequencing ...
-
bioRxiv - Immunology 2020Quote: ... from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... Total viral RNA was extracted from patient specimens and tested for the presence of SARS-CoV-2 with an EZ1 virus extraction kit and EZ1 Advanced XL instrument with the Virus card (Qiagen), or QIASymphony DSP Virus kit and QIASymphony instrument (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... HIV-1 RNA was analyzed using the QuantiTect SYBR Green RT-PCR kit (Qiagen) in a LightCycler 480 (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Virus was inactivated by mixing 1:1 with Buffer ATL (Qiagen) prior to viral RNA extraction from NP swabs ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 RNA in plasma was extracted using the QIAamp Viral RNA Mini Kit (Qiagen). To amplify the 3’ half viral genome ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was subsequently isolated from mouse plasma using the MinElute Virus Kit (Qiagen) on the QiaCube ...
-
bioRxiv - Microbiology 2020Quote: ... Virus RNA virus was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 RNA was extracted from plasma samples using QIAamp Viral RNA Mini Kit (Qiagen, #52904). Followed by first-strand cDNA synthesis using Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen, Toronto, ON, Canada). Then ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Microbiology 2020Quote: Total cellular RNA was extracted from Jurkat cells infected with HIV-1 using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: HIV-1 viral RNA was extracted from 20-50 ul of plasma using QIAamp Viral RNA mini kit (Qiagen). qRT-PCR was performed using a TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Cell Biology 2021Quote: Plasma HIV RNA was isolated with the QIAamp Viral RNA Kit (Qiagen) and quantified using the Abbott RealTime HIV-1 Amplification Reagent Kit following the manufacturer’s protocols ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from 140 µl of virus stock (SARS-CoV-2 VOC Delta, GISAID ID: EPI_ISL_15250227) using a QIAamp Viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... QIAsymphony DSP virus/pathogen Kit (Qiagen) for blood samples ...
-
bioRxiv - Microbiology 2023Quote: ... with EZ1 DSP Virus kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... using Virus Extraction Mini Kit (Qiagen). The RT-qPCR assay were performed with a SuperScript III Platinum One-Step RT-qPCR Kit with ROX (Invitrogen - Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: The SARS-CoV-2 RNA was isolated from virus particles with the QIAmp viral RNA mini kit (Qiagen - USA) and reversely transcribed to cDNA with the High-Capacity Reverse Transcription Kit (Thermo - USA) ...
-
bioRxiv - Immunology 2021Quote: Purified ZIKV RNA and HSV-2 DNA were extracted using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704), and 50ng purified viral RNA/DNA was incubated with the recombinant protein at different concentrations for 90min at 37°C in the presence of SUPERase In™ RNase inhibitor (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from virus supernatants using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qPCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from SIV and SIVΔNef virus stocks with the QIAamp UltraSens Virus kit (Qiagen, Germantown, MD), reverse transcribed with the Superscript VILO kit (Thermofisher ...
-
bioRxiv - Microbiology 2019Quote: For viral genome copy measurements RNA was extracted from 2 µl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed with a primer set targeting partial regions of the ORF1b gene in the SARS-CoV-2 virus using the QIAGEN OneStep RT-PCR kit (Qiagen) as previously reported (51) ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... with the Virus Mini Kit v2.0 (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Immunology 2021Quote: ... ZIKA Viral RNA was isolated from Zika virus stock using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704) to create a standard curve using serial 10-fold dilutions of ZIKV RNA ...
-
bioRxiv - Microbiology 2022Quote: ... copies were extracted from plasma virus using the Qiagen BioRobot EZ1 Workstation with EZ1 Virus Mini Kit v2.0 (Qiagen). Eluted vRNA was subsequently used as a template for cDNA synthesis and reverse-transcribed using the reverse primer SHIV.Env.R1 (5’-TACCCCTACCAAGTCATCA-3’ ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was extracted from 10 ul of the purified virus using the MinElute Virus Spin Kit (Qiagen Cat#57704), and the viral genome titer was determined by qPCR using an AAV2 rep gene specific primer probe set (repF ...
-
bioRxiv - Microbiology 2021Quote: ... For next generation sequencing RNA from virus-containing samples were extracted using the QIAsymphony DSP Virus/Pathogen mini kit (Qiagen). RNA was DNase-treated using the TURBO-free Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Whole genome sequencing of the isolated virus was done isolating viral RNA using the QIAamp MinElute Virus Spine kit (Qiagen) and performing Illumina sequencing ...