Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... or mock digestion (protocol without RNase R) followed by clean-up with the Qiagen RNeasy Mini kit (Q74106, Qiagen). RNA-seq libraries were prepared with the TruSeq Stranded Illumina Total RNA Preparation Kit (20020599 ...
-
bioRxiv - Molecular Biology 2022Quote: ... serum or cell medium was extracted using the QIAmp DNA Mini Blood kit (Qiagen), used according to the ‘‘Blood and body fluid protocol’’ ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA was extracted from 200 μl conditioned medium or 100 μl foetal plasma using the miRNeasy Mini Kit and the miRNeasy Serum/Plasma Kit (Qiagen, Germany). microRNA expression levels were analysed using the nCounter Rat v1.5 miRNA Expression Assay (NanoString Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and small intestine without contents using the RNeasy Mini Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... serum-free medium and HiPerFect Transfection Reagent (Qiagen, Hilden, Germany) were premixed and incubated with cells according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Drosophila S2 cells were cultured in Excel media without fetal bovine serum (FBS) and co-transfected with Effectene (Qiagen). The expression of the copper-inducible transgenes was induced by adding CuSO4 (700 µM ...
-
bioRxiv - Molecular Biology 2022Quote: RNeasy Serum/Plasma Kit (217184, Qiagen) was used to isolate the RNA from the EVs and HDL particles according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Extracellular RNA was extracted from 200 μl of microglia-conditioned culture medium using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, 217204). The QIAseq miRNA Library Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: miRNAs were extracted from serum (miRNeasy Serum/Plasma Advanced kit QIAGEN, Hilden, Germany) with the spike-in control cel-miR-39-3p (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: The exoRNeasy serum/plasma maxi kit (Qiagen) was used to isolate extracellular vesicles ...
-
bioRxiv - Cell Biology 2021Quote: ... using the exoRNeasy Serum/Plasma Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2024Quote: ... using the miRNeasy serum/plasma kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: DNA was extracted using either the DNeasy(R) kit (Qiagen) or the method described by Poudel et al ...
-
bioRxiv - Cell Biology 2023Quote: ... MI and MI/R using RNeasy RNA isolation Kit (Qiagen) coupled with an on-column DNase I digestion to eliminate residual DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... A miRNeasy serum/plasma kit (Qiagen, Venlo, Nederland) was used to extract miRNAs from each 200-μL serum sample according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The miRNeasy serum/plasma kit (Qiagen, Cat #217184) was used to isolate total RNA from EVs following the manufacturer’s protocol with minor adaptations ...
-
bioRxiv - Genomics 2022Quote: ... miRNeasy Serum/Plasma Advanced Kit (MIRA; Qiagen, 217204), mirVana PARIS Kit (MIRV ...
-
bioRxiv - Microbiology 2023Quote: DNA was isolated from microbiome samples (with and without PMA) using the DNeasy PowerSoil Kit (Qiagen) (Figures 2-5 ...
-
bioRxiv - Microbiology 2024Quote: ... Soil supernatants without pre-enrichment were extracted using the DNeasy PowerSoil Pro kit (QIAGEN, Hilden, Germany), while supernatants from enriched soil/water samples and rectal swabs were extracted using the High Pure PCR Template Preparation kit (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Bioengineering 2019Quote: ... and the exoRNeasy Serum/Plasma Starter Kit (Qiagen, 77023) following the vendor’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without RNase-A (Qiagen #19101 ...
-
bioRxiv - Genomics 2021Quote: ... The adaptor-ligated DNA were cleaned without size selection using the MinElute® PCR Purification Kit (QIAGEN, Germany), following the instructions provided by the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was isolated from roots treated with or without bleomycin using an RNeasy Plant Mini Kit (Qiagen), labeled using a Low Input Quick-Amp Labeling Kit (Agilent Technologies) ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated from cells grown with and without IPTG using the RNeasy mini kit (Qiagen. Inc), followed by DNase treatment with the TURBO DNA-free kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... direct RT-qPCRs were performed on heat-inactivated samples without extraction using the QuantiTect Reverse Transcription Kit (Qiagen). The reactions were run in an Applied Biosystems QuantStudio 7 Flex System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted by miRNeasy Serum/Plasma Kit (Qiagen 217184) per manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: Micro RNA was extracted from 200 uL serum samples using miRNeasy Serum/Plasma Advanced Kit (Qiagen, Hilden, Germany) according to the manufacturer’s manual ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA isolated from shoots and roots treated with or without bleomycin using an RNeasy Plant Mini Kit (Qiagen) was treated with DNase I (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from tibial nerves (without epineurium) using QIAzol lysis reagent and was purified according to manufacturer’s instructions using RNeasy Kit (Qiagen). The concentration and purity of the RNA was determined with the ratio of absorption at 260/280 nm using NanoDrop 2000 Spectraphotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was extracted from cells maintained in low-serum conditions (0.5% calf serum) for 22 hours using RNeasy purification kit (Qiagen) and treated with DNase on column ...
-
bioRxiv - Cell Biology 2020Quote: ... exosomal RNA was isolated using the miRNeasy Serum/Plasma Kit (QIAGEN) followed by reverse transcription using the TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... BALF and serum using QIAamp Viral RNA kit (QIAGEN, Manchester, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: RNA isolation was performed using the miRNeasy Serum/Plasma Kit (Qiagen). In experiment 1 ...
-
bioRxiv - Genomics 2021Quote: RNA was isolated with the miRNeasy Serum/Plasma Kit (Qiagen, #217184) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: sRNA was isolated using the miRNeasy Serum/Plasma Advanced Kit (Qiagen) according to the manufactureŕs instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and from EVs using the Serum/Plasma miRNeasy Kit (Qiagen, Germany). MiR quantification from all samples was completed with microRNA Qubit (Thermo Fisher Scientific ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: ... All salivary miRNA were extracted using miRNeasy Serum/Plasma Kit (Qiagen) according to the instruction of the manufacturer except for the elution step in which extracted salivary small RNAs were collected in 20 μL nuclease free water ...
-
bioRxiv - Cancer Biology 2022Quote: c-miR isolations from blood serum were carried out using affinity column-based miRNeasy Serum/Plasma Advanced Kit (217204, Qiagen) according to the manufacturer’s instructions ...
-
A Non-invasive, Biomarker Assay for Detecting Chronic Wasting Disease Pathology in White-tailed DeerbioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from 200 uL of serum using the miRNeasy Serum/Plasma Kit (Qiagen Inc., Valencia, California, USA) per manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA was isolated from 200 μL mouse serum following a standardized protocol (PMID: 24357537) using the miRNeasy Serum Plasma kit with ce-miR-39 spike-in (QIAGEN), QIAcube (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted with the RNeasy Mini Kit (tissues) or Viral RNA Mini Kit (serum) (Qiagen). ZIKV RNA levels were determined by TaqMan one-step quantitative reverse transcription PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from Doxycycline-inducible p53 expressing RPETert cells (treated with or without doxycycline) using the RNeasy kit (QIAGEN). 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Genetics 2021Quote: ... Swabs were stored without media at - 20°C until DNA was extracted with QiaAmp DNA Mini kit (Qiagen, Germantown, MD). Nasal shedding status of M ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA extracted from ID8 and OAW28 cells with or without SMARCA4-deficiency using the RNeasy Mini Kit (74104, Qiagen) was subjected to ribodeplete RNA-sequencing at MSK’s Integrated Genomics Operation (IGO) ...
-
bioRxiv - Plant Biology 2024Quote: RNA was extracted from five-day-old green seedlings with or without four hours of 27°C treatment of each genotype using the RNeasy Plant Kit (Qiagen). For mRNA sequencing (mRNA-seq ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated from 9 AAA and 10 PAD patients’ serum using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, Hilden, Germany), following in principle the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... DNA was isolated from serum using a QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated from PBC using miRNeasy serum/plasma kit (Qiagen) with 700 μL QIAzol Lysis buffer and 140 μL chloroform according to the manufacturer’s instructions ...