Labshake search
Citations for Qiagen :
1 - 50 of 611 citations for MAX Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... His- tagged human UHRF1 was purified using Ni-NTA sepharose resin (Qiagen). Recombinant E1 (His-UBE1) ...
-
bioRxiv - Immunology 2021Quote: ... and HRP-anti-His (Penta-His Ab, Qiagen) was used in the detection step ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... penta-HIS (QIAGEN) or α-RF1 E.coli (Zaher Lab ...
-
bioRxiv - Cell Biology 2021Quote: ... penta-His (Qiagen). Membranes were then incubated with fluorophore-conjugated secondary antibodies diluted 1:20,000 in TBS-T and 5% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Plant Biology 2023Quote: ... and digested with DNase Max (Qiagen). Preparation of RNA library (non-directional 250∼300 bp insert cDNA library (NEB) ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Plant Biology 2022Quote: ... bound His-mSTIC2 protein was detected by anti His HRP conjugate (Qiagen) and ECL reaction (Pierce).
-
bioRxiv - Plant Biology 2020Quote: Digestion with DNase Max (Qiagen, Hilden, Germany) was subsequently conducted to purify RNA isolates from remaining genomic DNA contamination.
-
bioRxiv - Plant Biology 2022Quote: ... 500 ng of DNAse (Max Kit, Qiagen) treated-RNAs were retro-transcribed using random hexo-nucleotides or reverse gene-specific primers and the Super-Script II enzyme (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Penta-His from QIAGEN; CD63 (clone H5C6 ...
-
bioRxiv - Microbiology 2020Quote: ... His-Penta-Conjugate (Qiagen) was then used as the secondary antibody (1:5000) ...
-
bioRxiv - Immunology 2020Quote: ... and detection was performed using anti-His antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... immunoprecipitated RNAs were treated with DNase Max (QIAGEN). Two biological and three technical repeats were performed and a RIP experiment with untransformed PSBD cells was used as negative control.
-
bioRxiv - Plant Biology 2022Quote: RNA samples were treated with DNase Max (QIAGEN) for 30 min at 37°C and transcribed using the M-MLV-Reverse Transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... DNase treatment was performed using DNase Max (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... His-EHD1 was purified by binding with Ni2+-NTA His-bind slurry (Qiagen, Germany) and eluting with imidazole as described previously (65) ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Cell Biology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... and anti-His (Qiagen 34660) antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-RGS-His (Qiagen, 34610), anti-Vinculin (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-penta-His (34660, Qiagen), anti-GFP-HRP (B-2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His (Qiagen 34660) antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was removed with the DNase Max Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Microbiology 2019Quote: ... and HRP-penta-His antibody (Qiagen) and HRP-anti-mouse IgG (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Microbiology 2019Quote: ... Penta His HRP conjugate (Qiagen, 34460) was diluted 1:5000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN, Cat. No. 30210) according to the product protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Trace DNA was digested using the DNase Max Kit (Qiagen). RNA quantity and integrity was confirmed with nanodrop (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleaved CK1δ ΔC was further purified away from His-GST and His-TEV using Ni-NTA resin (Qiagen) and subsequent size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... the Penta-His HRP Conjugate Kit (Qiagen) was used following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... The Penta-His HRP Conjugate Kit (Qiagen) was used for detection of His-tagged proteins according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid preparations were performed using a Plasmid Max Kit (Qiagen #12165). The Zhx2 expression plasmid was described previously.7
-
bioRxiv - Molecular Biology 2022Quote: Contaminating genomic DNA was removed using the DNase Max Kit (Qiagen). 10 μL of a 1x Master Mix (5 μL 10X Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA extracts were treated with the DNase Max Kit (QIAGEN), following the manufacturer’s protocol ...