Labshake search
Citations for Qiagen :
1 - 50 of 420 citations for L Leucine N T Boc H2O 13C6 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... and the reminder 45 nt sequences were aligned to the GRCh38 Mus-Musculus reference genome (Ensembl rel. 97) using the CLC Genomics Workbench (CLC Bio) (v.20, QIAGEN Bioinformatics). An eight-nucleotide UMI tag and mapping coordinates were used to remove PCR-duplicate reads ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was extracted from the red blood cells of the parents and 99 F2 hybrid females using the DNeasy Blood & Tissue Kit (Qiagen). The library was constructed according to a previously described method [27] ...
-
bioRxiv - Immunology 2023Quote: ... The SARS-CoV-2 N gene-specific primers were used to amplify a 97 bp product by conventional PCR and this was purified by the Qiagen gel extraction kit (Qiagen, CA, USA). The purified N gene PCR products were used in real-time PCR to prepare a standard curve ...
-
bioRxiv - Genetics 2021Quote: ... 0.4 μl H2O (Type-it Kit, QIAGEN) and 75 μg of template DNA ...
-
bioRxiv - Immunology 2020Quote: ... and 0.095 μl PCR-grade H2O (Qiagen). Reverse transcription was performed in a thermal cycler (lid temperature 70°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 7.5 μL of RNAse free H2O and 10 μL of 2X HotStarTaq™ Plus Master Mix (HotStarTaq™ Plus Master Mix Kit, Qiagen, USA). PCR conditions were an initial denaturation of 5 min at 95°C followed by 25 cycles of 30 s at 95°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2021Quote: ... and DNA eluted in 25 µL nuclease-free H2O (Qiagen). When required ...
-
bioRxiv - Microbiology 2022Quote: ... unlinked PCR products were prepared in DNAse free H2O (Qiagen) and adjusted to 1 ng μL-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... Samples were stored in RNase free H2O (#74134, Qiagen, Germantown, MD) at -80°C until sent for sequencing.
-
bioRxiv - Pathology 2022Quote: ... 200 μL of H2O and 100 μg RNAse A (QIAGEN, Hilden, Germany) were added before incubating for 1 hr at 65 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 11.5 μl of molecular grade H2O and 0.1 μl HotStarTaq DNA Polymerase (Qiagen, Cat# 203203). Reactions were incubated at 95°C for 15 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 0.125 μl 20 μM SmarterR reverse primer (30) and 1 μl PCR-grade H2O (Qiagen). The amplification was performed in a thermal cycler (lid temperature 98°C ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA from parental and all second-generation hybrid offspring (KonPar: N = 263; PruKoh: N = 193; CerEuk: N = 230) was isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) and sequenced following the Genotype-By-Sequencing (GBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from cultured in vitro or in vivo primed T cells or ex vivo sorted T cells using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl of amplified cDNA from each well of a 96-well plate were pooled and completed to 500 μl with PCR-grade H2O (Qiagen). Two rounds of 0.6X solid-phase reversible immobilization beads (AmpureXP ...
-
bioRxiv - Immunology 2020Quote: ... cleaning were used to purify 100 μl of pooled cDNA with final elution in 15 μl PCR-grade H2O (Qiagen). After quantification with Qubit dsDNA HS assay (Thermofisher) ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was eluted from the column in RNase/DNase free H2O and any residual DNA contamination was removed with a 1 hour off-column DNase treatment (Qiagen). The RNA was purified following the RNeasy Mini-Prep Kit following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA of CDC-EVs (n=12) and MSC-EVs (n=4) was extracted using the miRNeasy Serum/Plasma kit (QIAGEN). Library construction was performed according to the manufacturer’s protocol using the TruSeq small RNA Library Kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from SK-N-AS and SK-N-BE(2) xenograft tissue using the RNeasy Mini Kit (Qiagen) and quality control was performed with Agilent Tapestation according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Cell Biology 2022Quote: HCEC-B4G12 (n = 9) and F35T (n = 6) cells were pelleted and RNA was extracted and purified using RNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... and chestnut oak with FUSE (n = 9) and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Physiology 2021Quote: ... males n=11) and Ob (females n=10, males n=10) offspring using a commercially available kit (RNeasy Plus mini Kit, Qiagen) then reverse transcribed to cDNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: Total DNA was extracted from bulk (n = 23) and rhizosphere (n = 23) soils using the PowerSoil DNA Kit or the PowerSoil Pro Kit (QIAGEN) following the manufacturer’s protocols with minor modifications ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated and purified from both the livers of control and N-LKO mice or tumors of N-LKO mice using a RNA isolation Kit from Qiagen, followed by DNAse treatment to eliminate any genomic contamination using RNA Min Elute Cleanup from Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... resulting in an N-terminal 6xHis-tag (Qiagen) for each construct and were then cloned into E ...
-
bioRxiv - Genetics 2019Quote: ... protein altering inframe InDels (n=28) and missense variants (n=557) were uploaded to Ingenuity pathway Analysis (Qiagen, Venlo, The Netherlands). Additionally ...
-
bioRxiv - Microbiology 2019Quote: ... sterile Dacron swabs (N = 11) and blank DNA extraction kits (N = 23)) using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germantown, MD) with minor modifications to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...