Labshake search
Citations for Qiagen :
1 - 50 of 868 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... and the reminder 45 nt sequences were aligned to the GRCh38 Mus-Musculus reference genome (Ensembl rel. 97) using the CLC Genomics Workbench (CLC Bio) (v.20, QIAGEN Bioinformatics). An eight-nucleotide UMI tag and mapping coordinates were used to remove PCR-duplicate reads ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was extracted from the red blood cells of the parents and 99 F2 hybrid females using the DNeasy Blood & Tissue Kit (Qiagen). The library was constructed according to a previously described method [27] ...
-
bioRxiv - Immunology 2023Quote: ... The SARS-CoV-2 N gene-specific primers were used to amplify a 97 bp product by conventional PCR and this was purified by the Qiagen gel extraction kit (Qiagen, CA, USA). The purified N gene PCR products were used in real-time PCR to prepare a standard curve ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cell Biology 2022Quote: HUVECs were transfected at 60% confluency with 10 nmol/L locked nucleic acid (LNA) GapmeRs (Qiagen) or small interfering RNAs (siRNAs ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA from parental and all second-generation hybrid offspring (KonPar: N = 263; PruKoh: N = 193; CerEuk: N = 230) was isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) and sequenced following the Genotype-By-Sequencing (GBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Puregene Core Kit B (Qiagen). Homozygously edited cells were identified using PCR and Sanger sequencing of gel extracted fragments (gel extraction performed using QIAquick Gel Extraction Kit from Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from cultured in vitro or in vivo primed T cells or ex vivo sorted T cells using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA of CDC-EVs (n=12) and MSC-EVs (n=4) was extracted using the miRNeasy Serum/Plasma kit (QIAGEN). Library construction was performed according to the manufacturer’s protocol using the TruSeq small RNA Library Kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from SK-N-AS and SK-N-BE(2) xenograft tissue using the RNeasy Mini Kit (Qiagen) and quality control was performed with Agilent Tapestation according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Cell Biology 2022Quote: HCEC-B4G12 (n = 9) and F35T (n = 6) cells were pelleted and RNA was extracted and purified using RNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... and chestnut oak with FUSE (n = 9) and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Physiology 2021Quote: ... males n=11) and Ob (females n=10, males n=10) offspring using a commercially available kit (RNeasy Plus mini Kit, Qiagen) then reverse transcribed to cDNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: Total DNA was extracted from bulk (n = 23) and rhizosphere (n = 23) soils using the PowerSoil DNA Kit or the PowerSoil Pro Kit (QIAGEN) following the manufacturer’s protocols with minor modifications ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated and purified from both the livers of control and N-LKO mice or tumors of N-LKO mice using a RNA isolation Kit from Qiagen, followed by DNAse treatment to eliminate any genomic contamination using RNA Min Elute Cleanup from Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... resulting in an N-terminal 6xHis-tag (Qiagen) for each construct and were then cloned into E ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Neuroscience 2024Quote: ... Locked nucleic acid (LNA) probes (Qiagen) to detect either sense (5’ TYE563-labelled CCCCGGCCCCGGCCCC ...
-
bioRxiv - Genetics 2019Quote: ... protein altering inframe InDels (n=28) and missense variants (n=557) were uploaded to Ingenuity pathway Analysis (Qiagen, Venlo, The Netherlands). Additionally ...
-
bioRxiv - Microbiology 2019Quote: ... sterile Dacron swabs (N = 11) and blank DNA extraction kits (N = 23)) using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germantown, MD) with minor modifications to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pathways significantly affected in non-T cell-inflamed or non-T cell-inflamed-enriched mutated genes were identified by IPA® (QIAGEN Inc., Germany).
-
bioRxiv - Cell Biology 2020Quote: ... Circulating cell-free nucleic acid (ccfNA) was extracted using the Qiamp Circulating Nucleic Acid kit (Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: Genomic DNA was extracted from n=192 rhizosphere and n=192 bulk soil samples using the DNeasy PowerSoil kit (Qiagen, Hilden, Germany). Paired-end sequencing of a 300-bp sequence spanning the V4 region of the ribosomal 16 S rRNA was generated using the Illumina MiSeq platform (Illumina Inc. ...
-
bioRxiv - Epidemiology 2019Quote: ... Genomic DNA was extracted from female and male reproductive parts (RP, n = 1157) as well as from whole bodies (WB, n = 258) using DNeasy® Blood and Tissue Kit (Qiagen, Germany). We used flies from Pagirinya (PAG ...