Labshake search
Citations for Qiagen :
1 - 50 of 1331 citations for L Alanine N T Boc 2 13C 98 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Molecular basis of selective cytokine signaling inhibition by antibodies targeting a shared receptorbioRxiv - Immunology 2021Quote: Alanine mutants were generated by site-directed mutagenesis (Qiagen) of Fc-fused IL-1RAcP and the procurement of the alanine library from Günther et al ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Neuroscience 2023Quote: ... samples obtained by FACS together with 100 ng carrier RNA (PolyA- and PolyA+ mixed in 98:2 ratio) were lysed by Buffer RLT Plus (Qiagen, USA). Then we used PolyA mRNA Magnetic Isolation Module (NEBNext ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from SK-N-AS and SK-N-BE(2) xenograft tissue using the RNeasy Mini Kit (Qiagen) and quality control was performed with Agilent Tapestation according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... subtilis 3610 genome (CP020102) (98) using CLC Genomics Workbench software (Qiagen). The enrichment at ribosomal RNA locations were eliminated and the number of reads mapped to each base pair in the genome was exported into a .csv file ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Biophysics 2022Quote: ... combined with Ni-NTA resin (2 mL/1 L of biomass, Qiagen) pre-equilibrated with 40 mM sodium phosphate buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 2 hours we extracted the total RNA (RNeasy mini kit, Qiagen, cat. n. 74104) from 40 animals for each of the 3 experimental replicates (total ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Biochemistry 2023Quote: ... The SNAP- FKBP-ICD-His6 and SNAP-FRB-ICD-His6 alanine mutants were purified through Ni-NTA Agarose resin (Qiagen), followed by dialysis into 50KMEH5Gd ...
-
bioRxiv - Genomics 2021Quote: Total RNA was collected from 2×106 CAR T cells with the RNEasy Plus Mini isolation kit (Qiagen). Library preparation and RNA-seq was performed by BGI America (Cambridge ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Light organs were then transferred into 180 ul of pre-heated (98°C) ATL buffer (QIAGEN) and incubated at 98°C for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from MCF10AER/vSrc cells (Control and treated with 10 nM D-Alanine for 4 h or 24 h) using RNeasy Kit (Qiagen, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from SH-SY5Y and SK-N-BE(2) cells using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol including the on-column DNA digestion step ...
-
bioRxiv - Microbiology 2019Quote: Initial N-gene amplicon analysis was performed with 0.2 μl Round 2 product using the QIAxcel (Qiagen, Hilden, Germany). For positive reactions ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA from parental and all second-generation hybrid offspring (KonPar: N = 263; PruKoh: N = 193; CerEuk: N = 230) was isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) and sequenced following the Genotype-By-Sequencing (GBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Copies of SARS-CoV-2 nucleocapsid (N) gene in homogenized tissues were determined using QuantiNova SYBR Green PCR kit (Qiagen) along with 2019-nCoV RUO Kit (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was extracted from individual filter sets (n = 2 per timepoint) using Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) as in Harke et al ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Neuroscience 2023Quote: ... FACS-sorted cells (≈ 98% tdTomato+ cells) were harvested in RLT and RNA extracted with RNeasy Micro kit (Cat. # Qiagen). Around 100 000 tdTomato+ cells were sorted from 10 electroporated-brains for each sample to sequence ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from 0.25 g of soil from all segments from two of the five 13C soil cores using the DNeasy PowerSoil DNA Extraction kit (Qiagen, Hilden, Germany) to determine the segment with the highest abundance of methanogens or methanotrophs based on the respective functional marker genes using qPCR as described below ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...
-
bioRxiv - Microbiology 2022Quote: ... each sample was eluted in 40.5 µL elution buffer that was prepared by mixing 98 µL Buffer EB (Qiagen, CN 19086), 1 µL 10% Tween 20 (Teknova ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... 32 μl Master Mix containing 30 μl MDA reaction buffer and 2 μl Phi29 polymerase (REPLI-g UltraFast Mini Kit; Qiagen) were added ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from cultured in vitro or in vivo primed T cells or ex vivo sorted T cells using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 µL of RNase inhibitor and 98 µL nuclease-free water) and the eluted RNA was then concentrated using the RNeasy MinElute Cleanup kit (Qiagen, ref. 74204). The immunoprecipitated RNA was then reverse transcribed and used for qPCR ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was extracted from the red blood cells of the parents and 99 F2 hybrid females using the DNeasy Blood & Tissue Kit (Qiagen). The library was constructed according to a previously described method [27] ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA of CDC-EVs (n=12) and MSC-EVs (n=4) was extracted using the miRNeasy Serum/Plasma kit (QIAGEN). Library construction was performed according to the manufacturer’s protocol using the TruSeq small RNA Library Kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Cell Biology 2022Quote: HCEC-B4G12 (n = 9) and F35T (n = 6) cells were pelleted and RNA was extracted and purified using RNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...