Labshake search
Citations for Qiagen :
1 - 50 of 1015 citations for IL 2 Rat CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Biochemistry 2019Quote: ... and CHO-K1 cells respectively using a RNA isolation kit (RNeasy Mini Kit) from Qiagen. cDNAs were synthesized from the isolated RNA using a cDNA synthesis kit (Advantage RT-PCR kits ...
-
bioRxiv - Physiology 2020Quote: ... RNA samples from heart tissue and HEK and CHO cell pellets were purified using a RNeasy mini kit (Qiagen). RNA was reverse-transcribed to cDNA using an Applied Biosystems High-Capacity RNA-to-cDNA kit (Foster City ...
-
bioRxiv - Immunology 2019Quote: ... IL-23p19 primers were purchased from QIAGEN and the sequence for osteopontin primers are ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... rat MPG were harvested and kept in RNAlater (Qiagen) immediately after cavernosometry ...
-
bioRxiv - Cell Biology 2019Quote: ... then mixed with BioMag goat-rat IgG beads (Qiagen) and Ter119+ cells were depleted using a Dynal magnet (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... followed by magnetic depletion using goat anti-rat beads (QIAGEN). For adoptive transfer experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were mixed with anti-rat Ig magnetic beads (Qiagen BioMag), incubated for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... thymocytes were mixed with anti-rat IgG-conjugated BioMag beads (QIAgen) and incubated for 45 mins at 4°C on a MACSmix Tube Rotator (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2019Quote: ... cells were incubated with anti-rat Ig magnetic beads (Qiagen BioMag), and subjected to magnetic separation ...
-
bioRxiv - Cancer Biology 2020Quote: Total mRNA was extracted from dissected IL using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The tube indices from the QIAseq miRNA NGS 48 Index IL (Qiagen, 331595) were used for library preparation.
-
bioRxiv - Molecular Biology 2024Quote: ... IL]) and homogenized using a stainless steel bead in TissueLyser II (Qiagen, Germany) for 2 min at 30 Hz ...
-
bioRxiv - Bioengineering 2022Quote: ... and native rat tissue samples were homogenized in lysis Buffer RLT (Qiagen). Total RNA was isolated using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with goat anti-rat beads (QIAGEN, cat. no. 310107). For intracellular staining ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Cell Biology 2019Quote: ... The siRNA targeting rat Psmc1 included Rn_RGD:621097_1 FlexiTube siRNA (Qiagen, Cat# SI02002427) and Rn_RGD:621097_2 FlexiTube siRNA (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cultured rat embryonic striatal neurons following stimulation (RNeasy, Qiagen) and submitted to the Genomic scorelab at the Heflin Center for Genomic Sciences at the University of Alabama at Birmingham for library preparation as previously described17,47 ...
-
bioRxiv - Neuroscience 2021Quote: ... The gene primer for il-1α was a QuantiTect Primer Assay (Cat. No. QT00113505; Qiagen). The sequences for the remaining gene primers can be found in Table 1 and were ordered through Integrated DNA Technologies and diluted to 0.13 μM to be used for PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-22ra1fl/fl/Shh-Cre or WT controls using RNAeasy mini kit (Qiagen, cat: 74106). Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNAs were isolated from cerebral cortices (P15 rats) using Mini RNeasy kit (Qiagen) then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... A customized RT2 Profiler PCR array for rat angiogenesis markers (PARN 042Z, 330231, Qiagen) containing SYBR Green RT PCR assays for 84 genes of interest ...
-
bioRxiv - Cell Biology 2022Quote: Alox12b and Tgm1 shRNA knockdown in rat epidermal keratinocytes using SureSilencing shRNA plasmids (Qiagen) has been previously described (O’Shaughnessy et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was isolated from rat blood cells using QIAmp DNA Mini Kit (Qiagen, City, state) following manufacturer’s instructions using a QIAcube automated device ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Neuroscience 2022Quote: We isolated genomic DNA from rat tail tips using Qiagen genomic DNA extraction kit (Qiagen Inc., USA). We performed genotyping via PCR ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from rat or mouse hippocampal cultures using the RNeasy Mini Kit (Qiagen, #74104). DNA contamination was removed by digestion with DNase I (Qiagen ...
-
bioRxiv - Immunology 2021Quote: Total DNA was extracted from Wistar rat tissues samples using the DNeasy Blood & Tissue Kit (Qiagen, Germany) as per manufacturer’s instructions ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... B220 (RA3-6B2) and Ly-6C/G (RB6-8C5) and anti-rat IgG-coupled magnetic beads (Qiagen) as previously described [34] ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from rat lower esophageal tissues using the RNeasy Fibrous Tissue Kit (Qiagen, Germantown, MD). Each sample was homogenized in 400 µL of Buffer RLT with beta-mercaptoethanol for 3 – 10 second pulses with the homogenizer (Pro-Scientific Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... genomic DNA was extracted from rat PSC cell pellets using the DNeasy Blood and Tissue kit (Qiagen) and PCR was performed using the Platinum PCR SuperMix High-Fidelity kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from dissected male and female IL or FAC sorted cells using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was isolated from three independent HFK cell populations +/- IL-1β treatment using the RNeasy mini kit (Qiagen). PolyA selection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as transcript per million mapped reads (TPM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as reads per kilobase of transcript per million reads mapped (RPKM ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using a forward primer that has a unique index and the reverse primer has another unique index for dual indexing (QIAseq miRNA 96 Index Kit IL UDI, #331645, Qiagen). Successful library production ...
-
bioRxiv - Immunology 2023Quote: ... colonic Foxp3(GFP)+IL-10(Thy1.1)+ and Foxp3(GFP)+IL-10(Thy1.1)- cells were sorted into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... were used for preamplification and qPCR arrays (Rat Antibacterial Response, PARN-148ZE, and Human Antibacterial Response, PAHS-148ZC; Qiagen) were used for the expression analysis of 84 genes involved in innate antibacterial responses in human and rat respectively ...
-
bioRxiv - Biophysics 2019Quote: ... The cells were transiently transfected with cDNA encoding the rat TRPV2 and its mutants using the Effectene reagent (Qiagen) 48-72 hours before experiments ...
-
bioRxiv - Neuroscience 2020Quote: RNA from rat Schwann cell cultures or mouse nerve tissue was extracted using an RNeasy Micro Extraction Kit (Qiagen). RNA quality and concentration was determined after extraction using a nanodrop 2000 machine (Thermo) ...
-
bioRxiv - Immunology 2022Quote: ... TCRαβ+CD4-CD45RClow/- T cells from Il34+/+ and Il34-/- rats were extracted using RNeasy Mini Kit (QIAGEN, Hilden, Germany) and protocol of 3’ DGE RNA sequencing was performed as previously described (16) ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated from log-phase bacterial cells grown in the rat peritoneal cavity or in 2.5% NaCl HI broth using the RNeasy minikit (Qiagen). One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen ...