Labshake search
Citations for Qiagen :
1 - 50 of 1237 citations for IL 2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Immunology 2019Quote: ... IL-23p19 primers were purchased from QIAGEN and the sequence for osteopontin primers are ...
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cancer Biology 2020Quote: Total mRNA was extracted from dissected IL using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The tube indices from the QIAseq miRNA NGS 48 Index IL (Qiagen, 331595) were used for library preparation.
-
bioRxiv - Molecular Biology 2024Quote: ... IL]) and homogenized using a stainless steel bead in TissueLyser II (Qiagen, Germany) for 2 min at 30 Hz ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Neuroscience 2021Quote: ... The gene primer for il-1α was a QuantiTect Primer Assay (Cat. No. QT00113505; Qiagen). The sequences for the remaining gene primers can be found in Table 1 and were ordered through Integrated DNA Technologies and diluted to 0.13 μM to be used for PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-22ra1fl/fl/Shh-Cre or WT controls using RNAeasy mini kit (Qiagen, cat: 74106). Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...